Login to display prices
Login to display prices
CHST9-carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9 Gene View larger

CHST9-carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9 Gene

PTXBC025764

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CHST9-carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CHST9-carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9 Gene

Proteogenix catalog: PTXBC025764
Ncbi symbol: CHST9
Product name: CHST9-carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9 Gene
Size: 2ug
Accessions: BC025764
Gene id: 83539
Gene description: carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9
Synonyms: GALNAC4ST-2; GalNAc4ST2; carbohydrate sulfotransferase 9; GalNAc-4-sulfotransferase 2; N-acetylgalactosamine 4-O-sulfotransferase 2; carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9; galNAc-4-O-sulfotransferase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtcatgaaccccaaacaagtcttcctctctgtgctgatatttggagtagctgggctactcctcttcatgtatttgcaagtctggattgaagaacaacatacagggagagtggagaagagaagagaacaaaaagtaacttcaggatggggaccagtgaagtacttgcggcctgtacccagaatcatgagtacagaaaaaatccaggaacatatcaccaaccagaaccccaagtttcacatgcctgaggatgtacgagaaaaaaaggaaaatcttctactcaattctgagagatctactaggctcttaacaaagaccagtcattcacaaggaggggatcaagctttaagtaagtccacagggtcaccaacagagaagttgattgaaaaacgtcaaggagctaagactgtttttaacaagttcagcaacatgaattggccagtggacattcaccctttaaacaaaagtttagtcaaagataataaatggaagaaaactgaggagacccaagagaaacgaaggtctttccttcaggagttttgcaagaaatacggtggggtgagtcatcatcagtcacatctttttcatacagtatccagaatctatgtagaagataaacacaaaatcttatattgtgaggtacctaaggctggctgttccaattggaaaagaattctgatggtactaaatggattggcttcctctgcatacaacatctcccacaatgctgtccactacgggaagcatttgaagaagctagatagctttgacctaaaagggatatatacccgcttaaatacttacaccaaagctgtgtttgttcgtgatcccatggaaagattagtatcagcctttagggacaaatttgaacaccccaatagttattaccatccagtattcggaaaggcaattatcaagaaatatcgaccaaatgcctgtgaagaagcattaattaatggatctggagtcaagttcaaagagtttatccactacttgctggattcccaccgtccagtaggaatggacattcactgggaaaaggtcagcaaactctgctatccgtgtttgatcaactatgattttgtagggaaatttgagactttggaagaagatgccaattactttttacagatgatcggtgctccaaaggagctgaaatttcccaactttaaggataggcactcttccgatgaaagaaccaatgctcaagtcgtgagacagtatttaaaggatctgactagaactgagagacaattaatctatgacttttattacttggactatttaatgtttaattatacaactccatttttgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: