PACSIN1-protein kinase C and casein kinase substrate in neurons 1 Gene View larger

PACSIN1-protein kinase C and casein kinase substrate in neurons 1 Gene

PTXBC040228

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PACSIN1-protein kinase C and casein kinase substrate in neurons 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PACSIN1-protein kinase C and casein kinase substrate in neurons 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC040228
Product type: DNA & cDNA
Ncbi symbol: PACSIN1
Origin species: Human
Product name: PACSIN1-protein kinase C and casein kinase substrate in neurons 1 Gene
Size: 2ug
Accessions: BC040228
Gene id: 29993
Gene description: protein kinase C and casein kinase substrate in neurons 1
Synonyms: SDPI; protein kinase C and casein kinase substrate in neurons protein 1; syndapin I; syndapin-1; protein kinase C and casein kinase substrate in neurons 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccagctcctacgatgaggcctcactggcgccagaggagaccaccgacagcttctgggaggtggggaactacaagcggaccgtgaagcgcatcgatgacggccaccgtctatgcaacgacctgatgaactgcgtgcaggagcgcgccaagatcgagaaggcgtacgggcagcagctcaccgactgggccaagcgttggcgccagctcatcgagaaaggcccacagtatggcagcctggagcgggcctggggtgccataatgacagaggcagacaaggtgagcgagctgcaccaggaggtgaagaacaatctgctgaatgaggacctggagaaggtgaagaactggcagaaggacgcctatcacaagcagatcatgggtggcttcaaggagacgaaggaggctgaagatggcttccgcaaggcccagaagccttgggccaagaagatgaaggagctggaggcagccaagaaggcctaccatttggcttgcaaagaggaaaagctggccatgacacgggagatgaacagcaagacggagcaatcggtcacacctgagcagcaaaagaagctgcaggacaaagtggacaagtgcaagcaggatgtgcagaagacacaggagaagtatgagaaagtgctggaagatgtgggcaagaccacaccccagtacatggagaacatggagcaggtgtttgagcaatgccagcaatttgaggaaaagcggctggtcttcctcaaggaggtgctgctggacatcaaacggcacctcaacctggctgagaacagcagctacatccatgtgtaccgtgagctggagcaggccatccggggggctgatgcccaggaagacctcagatggttccgcagcaccagtggccccggcatgcccatgaactggccccagtttgaggagtggaacccagaccttcctcacaccaccaccaagaaggagaaacagcctaagaaggcagagggagtggcgctgaccaatgccactggggcggtagagtccacatcccaggctggggaccgcggcagtgttagcagctacgacagaggccagccctacgccaccgagtggtcagacgacgagagtgggaacccctttgggggcagtgagaccaacgggggcgccaacccctttgaggacgactccaagggagtgcgcgtgcgggcactctacgactatgacggccaggagcaggacgagctcagctttaaggccggagacgaactcaccaagctgggcgaggaggatgagcagggctggtgccgtgggcggctggacagcgggcagctgggcctctaccctgccaactacgtggaggctatctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - interferon-induced protein with tetratricopeptide repeats 1
- interferon-induced protein with tetratricopeptide repeats 2
- EGF-containing fibulin-like extracellular matrix protein 1
- prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)

Buy PACSIN1-protein kinase C and casein kinase substrate in neurons 1 Gene now

Add to cart