Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
LANCL1-LanC lantibiotic synthetase component C-like 1 (bacterial) Gene
PTXBC028685
New product
Data sheet of LANCL1-LanC lantibiotic synthetase component C-like 1 (bacterial) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LANCL1-LanC lantibiotic synthetase component C-like 1 (bacterial) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC028685 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LANCL1 |
| Origin species: | Human |
| Product name: | LANCL1-LanC lantibiotic synthetase component C-like 1 (bacterial) Gene |
| Size: | 2ug |
| Accessions: | BC028685 |
| Gene id: | 10314 |
| Gene description: | LanC lantibiotic synthetase component C-like 1 (bacterial) |
| Synonyms: | GPR69A; p40; lanC-like protein 1; 40 kDa erythrocyte membrane protein; G protein-coupled receptor 69A; LanC (bacterial lantibiotic synthetase component C)-like 1; LanC (bacterial lantibiotic synthetase component); LanC lantibiotic synthetase component C-like 1; LanC like 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctcaaagggccttcccgaatccttatgctgattataacaaatccctggccgaaggctactttgatgctgccgggaggctgactcctgagttctcacaacgcttgaccaataagattcgggagcttcttcagcaaatggagagaggcctgaaatcagcagaccctcgggatggcaccggttacactggctgggcaggtattgctgtgctttacttacatctttatgatgtatttggggaccctgcctacctacagttagcacatggctatgtaaagcaaagtctgaactgcttaaccaagcgctccatcaccttcctttgtggggatgcaggccccctggcagtggccgctgtgctatatcacaagatgaacaatgagaagcaggcagaagattgcatcacacggctaattcacctaaataagattgatcctcatgctccaaatgaaatgctctatgggcgaataggctacatctatgctcttctttttgtcaataagaactttggagtggaaaagattcctcaaagccatattcagcagatttgtgaaacaattttaacctctggagaaaacctagctaggaagagaaacttcacggcaaagtctccactgatgtatgaatggtaccaggaatattatgtaggggctgctcatggcctggctggaatttattactacctgatgcagcccagccttcaagtgagccaagggaagttacatagtttggtcaagcccagtgtagactacgtctgccagctgaaattcccttctggcaattaccctccatgtataggtgataatcgagatctgcttgtccattggtgccatggcgcccctggggtaatctacatgctcatccaggcctataaggtattcagagaggaaaagtatctctgtgatgcctatcagtgtgctgatgtgatctggcaatatgggttgctgaagaagggatatgggctgtgccacggttctgcagggaatgcctatgccttcctgacactctacaacctcacacaggacatgaagtacctgtatagggcctgtaagtttgctgaatggtgcttagagtatggagaacatggatgcagaacaccagacacccctttctctctctttgaaggaatggctggaacaatatatttcctggctgacctgctagtccccacaaaagccaggttccctgcatttgaactctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8 - oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) - carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9 - protein kinase C and casein kinase substrate in neurons 1 |