LANCL1-LanC lantibiotic synthetase component C-like 1 (bacterial) Gene View larger

LANCL1-LanC lantibiotic synthetase component C-like 1 (bacterial) Gene

PTXBC028685

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LANCL1-LanC lantibiotic synthetase component C-like 1 (bacterial) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LANCL1-LanC lantibiotic synthetase component C-like 1 (bacterial) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028685
Product type: DNA & cDNA
Ncbi symbol: LANCL1
Origin species: Human
Product name: LANCL1-LanC lantibiotic synthetase component C-like 1 (bacterial) Gene
Size: 2ug
Accessions: BC028685
Gene id: 10314
Gene description: LanC lantibiotic synthetase component C-like 1 (bacterial)
Synonyms: GPR69A; p40; lanC-like protein 1; 40 kDa erythrocyte membrane protein; G protein-coupled receptor 69A; LanC (bacterial lantibiotic synthetase component C)-like 1; LanC (bacterial lantibiotic synthetase component); LanC lantibiotic synthetase component C-like 1; LanC like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctcaaagggccttcccgaatccttatgctgattataacaaatccctggccgaaggctactttgatgctgccgggaggctgactcctgagttctcacaacgcttgaccaataagattcgggagcttcttcagcaaatggagagaggcctgaaatcagcagaccctcgggatggcaccggttacactggctgggcaggtattgctgtgctttacttacatctttatgatgtatttggggaccctgcctacctacagttagcacatggctatgtaaagcaaagtctgaactgcttaaccaagcgctccatcaccttcctttgtggggatgcaggccccctggcagtggccgctgtgctatatcacaagatgaacaatgagaagcaggcagaagattgcatcacacggctaattcacctaaataagattgatcctcatgctccaaatgaaatgctctatgggcgaataggctacatctatgctcttctttttgtcaataagaactttggagtggaaaagattcctcaaagccatattcagcagatttgtgaaacaattttaacctctggagaaaacctagctaggaagagaaacttcacggcaaagtctccactgatgtatgaatggtaccaggaatattatgtaggggctgctcatggcctggctggaatttattactacctgatgcagcccagccttcaagtgagccaagggaagttacatagtttggtcaagcccagtgtagactacgtctgccagctgaaattcccttctggcaattaccctccatgtataggtgataatcgagatctgcttgtccattggtgccatggcgcccctggggtaatctacatgctcatccaggcctataaggtattcagagaggaaaagtatctctgtgatgcctatcagtgtgctgatgtgatctggcaatatgggttgctgaagaagggatatgggctgtgccacggttctgcagggaatgcctatgccttcctgacactctacaacctcacacaggacatgaagtacctgtatagggcctgtaagtttgctgaatggtgcttagagtatggagaacatggatgcagaacaccagacacccctttctctctctttgaaggaatggctggaacaatatatttcctggctgacctgctagtccccacaaaagccaggttccctgcatttgaactctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8
- oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
- carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9
- protein kinase C and casein kinase substrate in neurons 1

Buy LANCL1-LanC lantibiotic synthetase component C-like 1 (bacterial) Gene now

Add to cart