HDHD2-haloacid dehalogenase-like hydrolase domain containing 2 Gene View larger

HDHD2-haloacid dehalogenase-like hydrolase domain containing 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HDHD2-haloacid dehalogenase-like hydrolase domain containing 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HDHD2-haloacid dehalogenase-like hydrolase domain containing 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC038100
Product type: DNA & cDNA
Ncbi symbol: HDHD2
Origin species: Human
Product name: HDHD2-haloacid dehalogenase-like hydrolase domain containing 2 Gene
Size: 2ug
Accessions: BC038100
Gene id: 84064
Gene description: haloacid dehalogenase-like hydrolase domain containing 2
Synonyms: 3110052N05Rik; HEL-S-301; haloacid dehalogenase-like hydrolase domain-containing protein 2; epididymis secretory protein Li 301; haloacid dehalogenase like hydrolase domain containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagcatgccgtgcattaaaagctgttttggtagatctcagtggcacacttcacattgaagatgcagctgtgccaggcgcacaggaagctcttaaaaggttacgtggtgcttctgtaatcattaggtttgtgaccaatacaaccaaagagagcaagcaagacctgttagaaaggttgagaaaattggaatttgatatctctgaagatgaaatattcacatctctgactgcagccagaagtttactagagcggaaacaagtcagacccatgctgctagttgatgatcgggcactacctgatttcaaaggaatacaaacaagtgatcctaatgctgtggtcatgggattggcaccagaacattttcattatcaaattctgaatcaagcattccggttactcctggatggagcacctctgatagcaatccacaaagccaggtattacaagaggaaagatggcttagccctggggcctggaccatttgtgactgctttagagtatgccacagataccaaagccacagtcgtggggaaaccagagaagacgttctttttggaagcattgcggggcactggctgtgaacctgaggaggctgtcatgataggagatgattgcagggatgatgttggtggggctcaagatgtcggcatgctgggcatcttagtaaagactgggaaatatcgagcatcagatgaagaaaaaattaatccacctccttacttaacttgtgagagtttccctcatgctgtggaccacattctgcagcacctattgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - major histocompatibility complex, class II, DR beta 5
- Fc fragment of IgG, low affinity IIIa, receptor (CD16a)
- StAR-related lipid transfer (START) domain containing 7
- polymerase (DNA-directed), delta interacting protein 2

Buy HDHD2-haloacid dehalogenase-like hydrolase domain containing 2 Gene now

Add to cart