Login to display prices
Login to display prices
HLA-DRB5-major histocompatibility complex, class II, DR beta 5 Gene View larger

HLA-DRB5-major histocompatibility complex, class II, DR beta 5 Gene

PTXBC009234

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HLA-DRB5-major histocompatibility complex, class II, DR beta 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HLA-DRB5-major histocompatibility complex, class II, DR beta 5 Gene

Proteogenix catalog: PTXBC009234
Ncbi symbol: HLA-DRB5
Product name: HLA-DRB5-major histocompatibility complex, class II, DR beta 5 Gene
Size: 2ug
Accessions: BC009234
Gene id: 3127
Gene description: major histocompatibility complex, class II, DR beta 5
Synonyms: major histocompatibility complex, class II, DR beta 5; DR beta-5; HLA class II histocompatibility antigen, DR-5 beta chain; MHC class II antigen DRB5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgtgtctgaagctccctggaggttcctacatggcaaagctgacagtgacactgatggtgctgagctccccactggctttggctggggacacccgaccacgtttcttgcagcaggataagtatgagtgtcatttcttcaacgggacggagcgggtgcggttcctgcacagagacatctataaccaagaggaggacttgcgcttcgacagcgacgtgggggagtaccgggcggtgacggagctggggcggcctgacgctgagtactggaacagccagaaggacttcctggaagacaggcgcgccgcggtggacacctactgcagacacaactacggggttggtgagagcttcacagtgcagcggcgagttgagcctaaggtgactgtgtatcctgcaaggacccagaccctgcagcaccacaacctcctggtctgctctgtgaatggtttctatccaggcagcattgaagtcaggtggttccggaacagccaggaagagaaggctggggtggtgtccacaggcctgattcagaatggagactggaccttccagaccctggtgatgctggaaacagttcctcgaagtggagaggtttacacctgccaagtggagcacccaagcgtgacgagccctctcacagtggaatggagagcacagtctgaatctgcacagagcaagatgctgagtggagtcgggggctttgtgctgggcctgctcttccttggggccgggctattcatctacttcaagaatcagaaagggcactctggacttcacccaacaggactcgtgagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: