TERF2IP-telomeric repeat binding factor 2, interacting protein Gene View larger

TERF2IP-telomeric repeat binding factor 2, interacting protein Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TERF2IP-telomeric repeat binding factor 2, interacting protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TERF2IP-telomeric repeat binding factor 2, interacting protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004465
Product type: DNA & cDNA
Ncbi symbol: TERF2IP
Origin species: Human
Product name: TERF2IP-telomeric repeat binding factor 2, interacting protein Gene
Size: 2ug
Accessions: BC004465
Gene id: 54386
Gene description: telomeric repeat binding factor 2, interacting protein
Synonyms: DRIP5; RAP1; telomeric repeat-binding factor 2-interacting protein 1; TERF2-interacting telomeric protein 1; TRF2-interacting telomeric RAP1 protein; dopamine receptor-interacting protein 5; repressor/activator protein 1 homolog; TERF2 interacting protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggaggcgatggatttgggcaaagaccccaacgggcccacccattcctcgactctgttcgtgagggacgacggcagctccatgtccttctacgtgcggcccagcccggccaagcgtcggctgtcgacgctcatcctgcacggcggcggcaccgtgtgccgagtgcaggagcccggggccgtgctgctggcccagcccggggaggcgctggccgaggcctcgggtgatttcatctccacgcagtacatcctggactgcgtggagcgcaacgagaggctggagctggaggcctatcggctgggccccgcctcggcggcggacaccggctcggaagcaaagcccggggccctggccgagggcgccgcggagccggagccgcagcggcacgccgggcggatcgccttcacggatgcggacgacgtagccatccttacctacgtgaaggaaaatgcccgctcgcccagctccgtcaccggtaacgccttgtggaaagcgatggagaagagctcgctcacgcagcactcgtggcagtccctgaaggaccgctacctcaagcacctgcggggccaggagcataagtacctgctgggggacgcgccggtgagcccctcctcccagaagctcaagcggaaggcggaggaggacccggaggccgcggatagcggggaaccacagaataagagaactccagatttgcctgaagaagagtatgtgaaggaagaaatccaggagaatgaagaagcagtcaaaaagatgcttgtggaagccacccgggagtttgaggaggttgtggtggatgagagccctcctgattttgaaatacatataactatgtgtgatgatgatccacccacacctgaggaagactcagaaacacagcctgatgaggaggaagaagaagaagaagaaaaagtttctcaaccagaggtgggagctgccattaagatcattcggcagttaatggagaagtttaacttggatctatcaacagttacacaggccttcctaaaaaatagtggtgagctggaggctacttccgccttcttagcgtctggtcagagagctgatggatatcccatttggtcccgacaagatgacatagatttgcaaaaagatgatgaggataccagagaggcattggtcaaaaaatttggtgctcagaatgtagctcggaggattgaatttcgaaagaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RNA binding motif, single stranded interacting protein 1
- StAR-related lipid transfer (START) domain containing 3
- StAR-related lipid transfer (START) domain containing 3
- tumor necrosis factor receptor superfamily, member 21

Buy TERF2IP-telomeric repeat binding factor 2, interacting protein Gene now

Add to cart