Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TERF2IP-telomeric repeat binding factor 2, interacting protein Gene
PTXBC004465
New product
Data sheet of TERF2IP-telomeric repeat binding factor 2, interacting protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TERF2IP-telomeric repeat binding factor 2, interacting protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004465 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TERF2IP |
| Origin species: | Human |
| Product name: | TERF2IP-telomeric repeat binding factor 2, interacting protein Gene |
| Size: | 2ug |
| Accessions: | BC004465 |
| Gene id: | 54386 |
| Gene description: | telomeric repeat binding factor 2, interacting protein |
| Synonyms: | DRIP5; RAP1; telomeric repeat-binding factor 2-interacting protein 1; TERF2-interacting telomeric protein 1; TRF2-interacting telomeric RAP1 protein; dopamine receptor-interacting protein 5; repressor/activator protein 1 homolog; TERF2 interacting protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggaggcgatggatttgggcaaagaccccaacgggcccacccattcctcgactctgttcgtgagggacgacggcagctccatgtccttctacgtgcggcccagcccggccaagcgtcggctgtcgacgctcatcctgcacggcggcggcaccgtgtgccgagtgcaggagcccggggccgtgctgctggcccagcccggggaggcgctggccgaggcctcgggtgatttcatctccacgcagtacatcctggactgcgtggagcgcaacgagaggctggagctggaggcctatcggctgggccccgcctcggcggcggacaccggctcggaagcaaagcccggggccctggccgagggcgccgcggagccggagccgcagcggcacgccgggcggatcgccttcacggatgcggacgacgtagccatccttacctacgtgaaggaaaatgcccgctcgcccagctccgtcaccggtaacgccttgtggaaagcgatggagaagagctcgctcacgcagcactcgtggcagtccctgaaggaccgctacctcaagcacctgcggggccaggagcataagtacctgctgggggacgcgccggtgagcccctcctcccagaagctcaagcggaaggcggaggaggacccggaggccgcggatagcggggaaccacagaataagagaactccagatttgcctgaagaagagtatgtgaaggaagaaatccaggagaatgaagaagcagtcaaaaagatgcttgtggaagccacccgggagtttgaggaggttgtggtggatgagagccctcctgattttgaaatacatataactatgtgtgatgatgatccacccacacctgaggaagactcagaaacacagcctgatgaggaggaagaagaagaagaagaaaaagtttctcaaccagaggtgggagctgccattaagatcattcggcagttaatggagaagtttaacttggatctatcaacagttacacaggccttcctaaaaaatagtggtgagctggaggctacttccgccttcttagcgtctggtcagagagctgatggatatcccatttggtcccgacaagatgacatagatttgcaaaaagatgatgaggataccagagaggcattggtcaaaaaatttggtgctcagaatgtagctcggaggattgaatttcgaaagaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RNA binding motif, single stranded interacting protein 1 - StAR-related lipid transfer (START) domain containing 3 - StAR-related lipid transfer (START) domain containing 3 - tumor necrosis factor receptor superfamily, member 21 |