TRAPPC6A-trafficking protein particle complex 6A Gene View larger

TRAPPC6A-trafficking protein particle complex 6A Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TRAPPC6A-trafficking protein particle complex 6A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TRAPPC6A-trafficking protein particle complex 6A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001907
Product type: DNA & cDNA
Ncbi symbol: TRAPPC6A
Origin species: Human
Product name: TRAPPC6A-trafficking protein particle complex 6A Gene
Size: 2ug
Accessions: BC001907
Gene id: 79090
Gene description: trafficking protein particle complex 6A
Synonyms: TRS33; trafficking protein particle complex subunit 6A; TRAPP complex subunit 6A; trafficking protein particle complex 6A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggatactgtgttgtttgagtttcttcacacggagatggtggctgagctgtgggctcacgaccccgaccccggcccgggggtgagcgccgggctccgtggggaggaagcgggggccaccaagggacagaagatgagcctgtcggtcctggagggtatggggttccgtgtgggccaggctctaggcgagaggctgccccgggagacgctggccttcagggaggagctggatgtcctcaagttcttgtgcaaagacctgtgggtggcggtgttccagaagcagatggacagcctgcgcaccaatcaccaggggacctacgtcctgcaagacaacagcttccccctcctcctcccgatggcctctggcctgcagtatctggaggaagcacccaagttcctggccttcacctgcggcctcctgcgcggcgccctctataccctgggcattgagagcgtggtcaccgcctccgtggcagccctgcccgtctgtaagttccaggtggtgattccgaaatcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - MpV17 mitochondrial inner membrane protein
- RNA binding protein with multiple splicing
- threonine synthase-like 1 (S. cerevisiae)
- survival motor neuron domain containing 1

Buy TRAPPC6A-trafficking protein particle complex 6A Gene now

Add to cart