Login to display prices
Login to display prices
RBPMS-RNA binding protein with multiple splicing Gene View larger

RBPMS-RNA binding protein with multiple splicing Gene

PTXBC003608

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RBPMS-RNA binding protein with multiple splicing Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RBPMS-RNA binding protein with multiple splicing Gene

Proteogenix catalog: PTXBC003608
Ncbi symbol: RBPMS
Product name: RBPMS-RNA binding protein with multiple splicing Gene
Size: 2ug
Accessions: BC003608
Gene id: 11030
Gene description: RNA binding protein with multiple splicing
Synonyms: HERMES; RNA-binding protein with multiple splicing; heart and RRM expressed sequence; RNA binding protein with multiple splicing
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacaacggcggcaaagccgagaaggagaacaccccgagcgaggccaaccttcaggaggaggaggtccggaccctatttgtcagtggccttcctctggatatcaaacctcgggagctctatctgcttttcagaccatttaagggctatgagggttctcttataaagctcacatctaaacagcctgtaggttttgtcagttttgacagtcgctcagaagcagaggctgcaaagaatgctttgaatggcatccgcttcgatcctgaaattccgcaaacactacgactagagtttgctaaggcaaacacgaagatggccaagaacaaactcgtagggactccaaaccccagtactcctctgcccaacactgtacctcagttcattgccagagagccatatgagctcacagtgcctgcactttaccccagtagccctgaagtgtgggccccgtaccctctgtacccagcggagttagcgcctgctctacctcctcctgctttcacctatcccgcttcactgcatgcccagtgtttctctcctgaggcaaagcccaacacacctgtcttttgtccacttctccagcaaattagatttgtctctgggaatgtgtttgtaacataccaacctactgcagaccagcagagggagctcccatgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: