Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of KCNK17-potassium channel, subfamily K, member 17 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNK17-potassium channel, subfamily K, member 17 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC025726 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNK17 |
| Origin species: | Human |
| Product name: | KCNK17-potassium channel, subfamily K, member 17 Gene |
| Size: | 2ug |
| Accessions: | BC025726 |
| Gene id: | 89822 |
| Gene description: | potassium channel, subfamily K, member 17 |
| Synonyms: | K2p17.1; TALK-2; TALK2; TASK-4; TASK4; potassium channel subfamily K member 17; 2P domain potassium channel Talk-2; TWIK-related acid-sensitive K(+) channel 4; TWIK-related alkaline pH-activated K(+) channel 2; acid-sensitive potassium channel protein TASK-4; potassium channel, two pore domain subfamily K, member 17; potassium two pore domain channel subfamily K member 17 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtaccgaccgcgagcccgggcggctcccgagggcagggtccggggctgcgcggtgcccggcaccgtgctcctgctgctcgcctacctggcttacctggcgctgggcaccggcgtgttctggacgctggagggccgcgcggcgcaggactccagccgcagcttccagcgcgacaagtgggagctgttgcagaacttcacgtgtctggaccgcccggcgctggactcgctgatccgggatgtcgtccaagcatacaaaaacggagccagcctcctcagcaacaccaccagcatggggcgctgggagctcgtgggctccttcttcttttctgtgtccaccatcaccaccattggctatggcaacctgagccccaacacgatggctgcccgcctcttctgcatcttctttgcccttgtggggatcccactcaacctcgtggtgctcaaccgactggggcatctcatgcagcagggagtaaaccactgggccagcaggctggggggcacctggcaggatcctgacaaggcgcggtggctggcgggctctggcgccctcctctcgggcctcctgctcttcctgctgctgccaccgctgctcttctcccacatggagggctggagctacacagagggcttctacttcgccttcatcaccctcagcaccgtgggcttcggcgactacgtgattggaatgaacccctcccagaggtacccactgtggtacaagaacatggtgtccctgtggatcctctttgggatggcatggctggccttgatcatcaaactcatcctctcccagctggagacgccagggagggtatgttcctgctgccaccacagctctaaggaagacttcaagtcccaaagctggagacagggacctgaccgggagccagagtcccactccccacagcaaggatgctatccagagggacccatgggaatcatacagcatctggaaccttctgctcacgctgcaggctgtggcaaggacagctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein 185B (pseudogene) - ubiquitin-like modifier activating enzyme 6 - pyruvate dehydrogenase (lipoamide) alpha 1 - O-sialoglycoprotein endopeptidase-like 1 |