UBA6-ubiquitin-like modifier activating enzyme 6 Gene View larger

UBA6-ubiquitin-like modifier activating enzyme 6 Gene

PTXBC031637

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBA6-ubiquitin-like modifier activating enzyme 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UBA6-ubiquitin-like modifier activating enzyme 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031637
Product type: DNA & cDNA
Ncbi symbol: UBA6
Origin species: Human
Product name: UBA6-ubiquitin-like modifier activating enzyme 6 Gene
Size: 2ug
Accessions: BC031637
Gene id: 55236
Gene description: ubiquitin-like modifier activating enzyme 6
Synonyms: UBA6, ubiquitin-activating enzyme E1; E1-L2; MOP-4; UBE1L2; ubiquitin-like modifier-activating enzyme 6; monocyte protein 4; ubiquitin-activating enzyme 6; ubiquitin-activating enzyme E1-like 2; ubiquitin-activating enzyme E1-like protein 2; ubiquitin like modifier activating enzyme 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaggatccgagcctgtggccgcccatcagggggaagaggcgtcctgttcttcctgggggactggcagcacaaataaaaatttgcccattatgtcaacagcatctgtggaaatcgatgatgcattgtatagtcgacagaggtacgttcttggagacacagcaatgcagaagatggccaagtcccatgttttcttaagtgggatgggtggtcttggtttggaaattgcaaagaatcttgttcttgcagggattaaggcagttacaattcatgatacagaaaaatgccaagcatgggatctaggaaccaacttctttctcagtgaagatgatgttgttaataagagaaacagggctgaagctgtacttaaacatattgcagaactaaatccatacgttcatgtcacatcatcttctgttcctttcaatgagaccacagatctctcctttttagataaataccagtgtgtagtattgactgagatgaaacttccattgcagaagaagatcaatgacttttgccgttctcagtgccctccaattaagtttatcagtgcagatgtacatggaatttggtcaaggttattttgtgatttcggtgatgaatttgaagttttagatacaacaggagaagaaccaaaagaaattttcatttcaaacataacgcaagcaaatcctggcattgttacttgccttgaaaatcatcctcacaaactggagacaggacaattcctaacatttcgagaaattaatggaatgacaggtttaaatggatctatacaacaaataacggtgatatcgccattttcttttagtattggtgacaccacagaactggaaccatatttacatggaggcatagctgtccaagttaagactcctaaaacagttttttttgaatcactggagaggcagttaaaacatccaaagtgccttattgtggattttagcaaccctgaggcacctttagagattcacacagctatgcttgccttggaccagtttcaggagaaatacagtcgcaagccaaatgttggatgccaacaagattcagaagaactgttgaaactagcaacatctataagtgaaaccttggaagagaaggtgactattgaaatttatggctgtccgaatatttgtttgttaatacataagtgttctgtatattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - pyruvate dehydrogenase (lipoamide) alpha 1
- O-sialoglycoprotein endopeptidase-like 1
- farnesyl-diphosphate farnesyltransferase 1
- interleukin-1 receptor-associated kinase 4

Buy UBA6-ubiquitin-like modifier activating enzyme 6 Gene now

Add to cart