IRAK4-interleukin-1 receptor-associated kinase 4 Gene View larger

IRAK4-interleukin-1 receptor-associated kinase 4 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IRAK4-interleukin-1 receptor-associated kinase 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about IRAK4-interleukin-1 receptor-associated kinase 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013316
Product type: DNA & cDNA
Ncbi symbol: IRAK4
Origin species: Human
Product name: IRAK4-interleukin-1 receptor-associated kinase 4 Gene
Size: 2ug
Accessions: BC013316
Gene id: 51135
Gene description: interleukin-1 receptor-associated kinase 4
Synonyms: IPD1; IRAK-4; NY-REN-64; REN64; interleukin-1 receptor-associated kinase 4; renal carcinoma antigen NY-REN-64; interleukin 1 receptor associated kinase 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacaaacccataacaccatcaacatatgtgcgctgcctcaatgttggactaattaggaagctgtcagattttattgatcctcaagaaggatggaagaagttagctgtagctattaaaaaaccatctggtgatgatagatacaatcagtttcacataaggagatttgaagcattacttcaaactggaaaaagtcccacttctgaattactgtttgactggggcaccacaaattgcacagttggtgatcttgtggatcttttgatccaaaatgaattttttgctcctgcaagtcttttgctcccagatgctgttcccaaaactgctaatacactaccttctaaagaagctataacagttcagcaaaaacagatgcctttctgtgacaaagacaggacattgatgacacctgtgcagaatcttgaacaaagctatatgccacctgactcctcaagtccagaaaataaaagtttagaagttagtgatacacgttttcacagtttttcattttatgaattgaagaatgtcacaaataactttgatgaacgacccatttctgttggtggtaataaaatgggagagggaggatttggagttgtatataaaggctacgtaaataacacaactgtggcagtgaagaagcttgcagcaatggttgacattactactgaagaactgaaacagcagtttgatcaagaaataaaagtaatggcaaagtgtcaacatgaaaacttagtagaactacttggtttctcaagtgatggagatgacctctgcttagtatatgtttacatgcctaatggttcattgctagacagactctcttgcttggatggtactccaccactttcttggcacatgagatgcaagattgctcagggtgcagctaatggcatcaattttctacatgaaaatcatcatattcatagagatattaaaagtgcaaatatcttactggatgaagcttttactgctaaaatatctgactttggccttgcacgggcttctgagaagtttgcccagacagtcatgactagcagaattgtgggaacaacagcttatatggcaccagaagctttgcgtggagaaataacacccaaatctgatatttacagctttggtgtggttttactagaaataataactggacttccagctgtggatgaacaccgtgaacctcagttattgctagatattaaagaagaaattgaagatgaagaaaagacaattgaagattatattgataaaaagatgaatgatgctgattccacttcagttgaagctatgtactctgttgctagtcaatgtctgcatgaaaagaaaaataagagaccagacattaagaaggttcaacagctgctgcaagagatgacagcttcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - heterogeneous nuclear ribonucleoprotein K
- zinc finger with KRAB and SCAN domains 3
- ankyrin repeat and KH domain containing 1
- membrane-associated ring finger (C3HC4) 10

Buy IRAK4-interleukin-1 receptor-associated kinase 4 Gene now

Add to cart