ZKSCAN3-zinc finger with KRAB and SCAN domains 3 Gene View larger

ZKSCAN3-zinc finger with KRAB and SCAN domains 3 Gene

PTXBC006118

New product

Data sheet of ZKSCAN3-zinc finger with KRAB and SCAN domains 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZKSCAN3-zinc finger with KRAB and SCAN domains 3 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC006118
Product type: DNA & cDNA
Ncbi symbol: ZKSCAN3
Origin species: Human
Product name: ZKSCAN3-zinc finger with KRAB and SCAN domains 3 Gene
Size: 2ug
Accessions: BC006118
Gene id: 80317
Gene description: zinc finger with KRAB and SCAN domains 3
Synonyms: ZF47; ZFP306; ZNF306; ZNF309; ZSCAN13; ZSCAN35; Zfp47; dJ874C20.1; dJ874C20.1; zfp-47; zinc finger protein with KRAB and SCAN domains 3; zinc finger and SCAN domain-containing protein 13; zinc finger protein 306; zinc finger protein 309; zinc finger protein 47 homolog; zinc finger protein zfp47; zinc finger with KRAB and SCAN domains 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctagagaattaagtgaaagcacagccctggatgcccagtctacagaagaccagatggagcttctggtcataaaggtggaggaagaagaagccggttttcccagtagcccagatctgggttctgagggctcccgcgagcgcttccgaggcttccgctacccggaggctgcaggcccccgcgaggcgctgagtcggctccgagagctctgccgacagtggctgcagcctgagatgcacagcaaggagcagatcctggagctgctggtgctggagcagttcctgaccatcctgccggggaatctgcagagctgggtgcgggagcagcatccagagagcggggaggaggtggtggtgctattggagtatttggagaggcagctggatgagccggcgccgcaggtttcaggtgttgaccaggggcaagaactgctctgttgcaagatggcactattgacaccagccccagggtcacaaagtagccaatttcagctaatgaaggctctgctcaagcatgaatctgtgggatcccagcctttacaagatagagttctccaggtccccatgcttgcccatggaggatgctgcagagaagatgcagtggtagcttctaggcttactccagagtcccaggggttgttgaaagtggaagatgtggccctgaccctcacccctgaatggacacagcaggattcatctcaggggaatctctgtagagatgaaaagcaggagaaccatggcagcctggtctccctgggtgatgaaaaacagactaagagcagggacttgcctccagctgaggagcttccagaaaaggagcatgggaagatatcgtgccacctgagagaagacattgcccagattcctacatgtgcagaagctggtgaacaggagggcaggctacaaagaaagcagaaaaatgccacaggagggaggcggcacatctgccatgaatgtggaaagagttttgctcaaagctcaggcctgagtaaacacaggagaatccacactggtgagaaaccctacgaatgtgaagagtgtggcaaagccttcattgggagctctgcccttgtcattcatcagagagtccacactggtgagaagccatatgagtgtgaagaatgtggtaaggccttcagtcatagctcagaccttatcaagcatcagagaacccacactggggagaagccctatgagtgtgatgactgtgggaagaccttcagccagagctgcagcctccttgaacatcacagaatccacactggggagaagccgtatcagtgcagtatgtgtggcaaagcctttaggcgaagttcacatctcctgagacatcagaggatccatactggggataaaaatgttcaggaacctgagcagggagaggcctggaaaagtaggatggaaagccagttggaaaatgttgaaactcccatgtcttataaatgtaatgagtgtgaaagaagtttcactcagaatacaggcctcattgaacatcaaaaaatccacactggtgagaaaccctatcagtgtaatgcgtgtggaaaaggcttcacccgaatttcataccttgttcaacatcagagaagccatgtagggaaaaacatcctatcacagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ankyrin repeat and KH domain containing 1
- membrane-associated ring finger (C3HC4) 10
- CDC28 protein kinase regulatory subunit 1B
- enhancer of rudimentary homolog (Drosophila)