Login to display prices
Login to display prices
ERH-enhancer of rudimentary homolog (Drosophila) Gene View larger

ERH-enhancer of rudimentary homolog (Drosophila) Gene

PTXBC014301

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ERH-enhancer of rudimentary homolog (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ERH-enhancer of rudimentary homolog (Drosophila) Gene

Proteogenix catalog: PTXBC014301
Ncbi symbol: ERH
Product name: ERH-enhancer of rudimentary homolog (Drosophila) Gene
Size: 2ug
Accessions: BC014301
Gene id: 2079
Gene description: enhancer of rudimentary homolog (Drosophila)
Synonyms: DROER; enhancer of rudimentary homolog; enhancer of rudimentary homolog (Drosophila)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctcacaccattttgctggtacagcctaccaagaggccagaaggcagaacttatgctgactacgaatctgtgaatgaatgcatggaaggtgtttgtaaaatgtatgaagaacatctgaaaagaatgaatcccaacagtccctctatcacatatgacatcagtcagttgtttgatttcatcgatgatctggcagacctcagctgcctggtttaccgagctgatacccagacataccagccttataacaaagactggattaaagagaagatctacgtgctccttcgtcggcaggcccaacaggctgggaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: