CALM1-calmodulin 1 (phosphorylase kinase, delta) Gene View larger

CALM1-calmodulin 1 (phosphorylase kinase, delta) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CALM1-calmodulin 1 (phosphorylase kinase, delta) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CALM1-calmodulin 1 (phosphorylase kinase, delta) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007965
Product type: DNA & cDNA
Ncbi symbol: CALM1
Origin species: Human
Product name: CALM1-calmodulin 1 (phosphorylase kinase, delta) Gene
Size: 2ug
Accessions: BC007965
Gene id: 801
Gene description: calmodulin 1 (phosphorylase kinase, delta)
Synonyms: CALML2; CAMI; CPVT4; DD132; LQT14; PHKD; caM; calmodulin 1 (phosphorylase kinase, delta); phosphorylase kinase subunit delta; phosphorylase kinase, delta subunit; prepro-calmodulin 1; calmodulin 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggtcactgggtcagaacccaacagaagctgaattgcaggatatgatcaatgaagtggatgctgatggtaatggcaccattgacttccccgaatttttgactatgatggctagaaaaatgaaagatacagatagtgaagaagaaatccgtgaggcattccgagtctttgacaaggatggcaatggttatatcagtgcagcagaactacgtcacgtcatgacaaacttaggagaaaaactaacagatgaagaagtagatgaaatgatcagagaagcagatattgatggagacggacaagtcaactatgaagaattcgtacagatgatgactgcaaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ropporin, rhophilin associated protein 1B
- ubiquitin-conjugating enzyme E2 variant 2
- calmodulin 1 (phosphorylase kinase, delta)
- calmodulin 3 (phosphorylase kinase, delta)

Buy CALM1-calmodulin 1 (phosphorylase kinase, delta) Gene now

Add to cart