CALM3-calmodulin 3 (phosphorylase kinase, delta) Gene View larger

CALM3-calmodulin 3 (phosphorylase kinase, delta) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CALM3-calmodulin 3 (phosphorylase kinase, delta) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CALM3-calmodulin 3 (phosphorylase kinase, delta) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005137
Product type: DNA & cDNA
Ncbi symbol: CALM3
Origin species: Human
Product name: CALM3-calmodulin 3 (phosphorylase kinase, delta) Gene
Size: 2ug
Accessions: BC005137
Gene id: 808
Gene description: calmodulin 3 (phosphorylase kinase, delta)
Synonyms: CaM; CaMIII; HEL-S-72; PHKD; PHKD3; calmodulin; epididymis secretory protein Li 72; phosphorylase kinase subunit delta; prepro-calmodulin 3; calmodulin 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgaccagctgactgaggagcagattgcagagttcaaggaggccttctccctctttgacaaggatggagatggcactatcaccaccaaggagttggggacagtgatgagatccctgggacagaaccccactgaagcagagctgcaggatatgatcaatgaggtggatgcagatgggaacgggaccattgacttcccggagttcctgaccatgatggccagaaagatgaaggacacagacagtgaggaggagatccgagaggcgttccgtgtctttgacaaggatgggaatggctacatcagcgccgcagagctgcgtcacgtaatgacgaacctgggggagaagctgaccgatgaggaggtggatgagatgatcagggaggctgacatcgatggagatggccaggtcaattatgaagagtttgtacagatgatgactgcaaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - calmodulin 2 (phosphorylase kinase, delta)
- tumor protein, translationally-controlled 1
- phosphatidylethanolamine binding protein 1
- hydroxysteroid (17-beta) dehydrogenase 8

Buy CALM3-calmodulin 3 (phosphorylase kinase, delta) Gene now

Add to cart