Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of CKS1B-CDC28 protein kinase regulatory subunit 1B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CKS1B-CDC28 protein kinase regulatory subunit 1B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007751 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CKS1B |
| Origin species: | Human |
| Product name: | CKS1B-CDC28 protein kinase regulatory subunit 1B Gene |
| Size: | 2ug |
| Accessions: | BC007751 |
| Gene id: | 1163 |
| Gene description: | CDC28 protein kinase regulatory subunit 1B |
| Synonyms: | CKS1; PNAS-16; PNAS-18; ckshs1; cyclin-dependent kinases regulatory subunit 1; CDC2-associated protein CKS1; CDC28 protein kinase 1; CDC28 protein kinase 1B; CKS-1; NB4 apoptosis/differentiation related protein; PNAS-143; cell division control protein CKS1; CDC28 protein kinase regulatory subunit 1B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgcacaaacaaatttactattcggacaaatacgacgacgaggagtttgagtatcgacatgtcatgctgcccaaggacatagccaagctggtccctaaaacccatctgatgtctgaatctgaatggaggaatcttggcgttcagcagagtcagggatgggtccattatatgatccatgaaccagaacctcacatcttgctgttccggcgcccactacccaagaaaccaaagaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - enhancer of rudimentary homolog (Drosophila) - calmodulin 1 (phosphorylase kinase, delta) - ropporin, rhophilin associated protein 1B - ubiquitin-conjugating enzyme E2 variant 2 |