CKS1B-CDC28 protein kinase regulatory subunit 1B Gene View larger

CKS1B-CDC28 protein kinase regulatory subunit 1B Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CKS1B-CDC28 protein kinase regulatory subunit 1B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CKS1B-CDC28 protein kinase regulatory subunit 1B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007751
Product type: DNA & cDNA
Ncbi symbol: CKS1B
Origin species: Human
Product name: CKS1B-CDC28 protein kinase regulatory subunit 1B Gene
Size: 2ug
Accessions: BC007751
Gene id: 1163
Gene description: CDC28 protein kinase regulatory subunit 1B
Synonyms: CKS1; PNAS-16; PNAS-18; ckshs1; cyclin-dependent kinases regulatory subunit 1; CDC2-associated protein CKS1; CDC28 protein kinase 1; CDC28 protein kinase 1B; CKS-1; NB4 apoptosis/differentiation related protein; PNAS-143; cell division control protein CKS1; CDC28 protein kinase regulatory subunit 1B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgcacaaacaaatttactattcggacaaatacgacgacgaggagtttgagtatcgacatgtcatgctgcccaaggacatagccaagctggtccctaaaacccatctgatgtctgaatctgaatggaggaatcttggcgttcagcagagtcagggatgggtccattatatgatccatgaaccagaacctcacatcttgctgttccggcgcccactacccaagaaaccaaagaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - enhancer of rudimentary homolog (Drosophila)
- calmodulin 1 (phosphorylase kinase, delta)
- ropporin, rhophilin associated protein 1B
- ubiquitin-conjugating enzyme E2 variant 2

Buy CKS1B-CDC28 protein kinase regulatory subunit 1B Gene now

Add to cart