HNRNPK-heterogeneous nuclear ribonucleoprotein K Gene View larger

HNRNPK-heterogeneous nuclear ribonucleoprotein K Gene

PTXBC000355

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HNRNPK-heterogeneous nuclear ribonucleoprotein K Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HNRNPK-heterogeneous nuclear ribonucleoprotein K Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000355
Product type: DNA & cDNA
Ncbi symbol: HNRNPK
Origin species: Human
Product name: HNRNPK-heterogeneous nuclear ribonucleoprotein K Gene
Size: 2ug
Accessions: BC000355
Gene id: 3190
Gene description: heterogeneous nuclear ribonucleoprotein K
Synonyms: AUKS; CSBP; HNRPK; TUNP; heterogeneous nuclear ribonucleoprotein K; dC-stretch binding protein; transformation upregulated nuclear protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaactgaacagccagaagaaaccttccctaacactgaaaccaatggtgaatttggtaaacgccctgcagaagatatggaagaggaacaagcatttaaaagatctagaaacactgatgagatggttgaattacgcattctgcttcagagcaagaatgctggggcagtgattggaaaaggaggcaagaatattaaggctctccgtacagactacaatgccagtgtttcagtcccagacagcagtggccccgagcgcatattgagtatcagtgctgatattgaaacaattggagaaattctgaagaaaatcatccctaccttggaagagggcctgcagttgccatcacccactgcaaccagccagctcccgctcgaatctgatgctgtggaatgcttaaattaccaacactataaaggaagtgactttgactgcgagttgaggctgttgattcatcagagtctagcaggaggaattattggggtcaaaggtgctaaaatcaaagaacttcgagagaacactcaaaccaccatcaagcttttccaggaatgctgtcctcattccactgacagagttgttcttattggaggaaaacccgatagggttgtagagtgcataaagatcatccttgatcttatatctgagtctcccatcaaaggacgtgcacagccttatgatcccaatttttacgatgaaacctatgattatggtggttttacaatgatgtttgatgaccgtcgcggacgcccagtgggatttcccatgcggggaagaggtggttttgacagaatgcctcctggtcggggtgggcgtcccatgcctccatctagaagagattatgatgatatgagccctcgtcgaggaccacctccccctcctcccggacgaggcggccggggtggtagcagagctcggaatcttcctcttcctccaccaccaccacctagagggggagacctcatggcctatgacagaagagggagacctggagaccgttacgacggcatggttggtttcagtgctgatgaaacttgggactctgcaatagatacatggagcccatcagaatggcagatggcttatgaaccacagggtggctccggatatgattattcctatgcagggggtcgtggctcatatggtgatcttggtggacctattattactacacaagtaactattcccaaagatttggctggatctattattggcaaaggtggtcagcggattaaacaaatccgtcatgagtcgggagcttcgatcaaaattgatgagcctttagaaggatccgaagatcggatcattaccattacaggaacacaggaccagatacagaatgcacagtatttgctgcagaacagtgtgaagcagtatgcagatgttgaaggattctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger with KRAB and SCAN domains 3
- ankyrin repeat and KH domain containing 1
- membrane-associated ring finger (C3HC4) 10
- CDC28 protein kinase regulatory subunit 1B

Buy HNRNPK-heterogeneous nuclear ribonucleoprotein K Gene now

Add to cart