Login to display prices
Login to display prices
THNSL1-threonine synthase-like 1 (S. cerevisiae) Gene View larger

THNSL1-threonine synthase-like 1 (S. cerevisiae) Gene

PTXBC016697

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of THNSL1-threonine synthase-like 1 (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about THNSL1-threonine synthase-like 1 (S. cerevisiae) Gene

Proteogenix catalog: PTXBC016697
Ncbi symbol: THNSL1
Product name: THNSL1-threonine synthase-like 1 (S. cerevisiae) Gene
Size: 2ug
Accessions: BC016697
Gene id: 79896
Gene description: threonine synthase-like 1 (S. cerevisiae)
Synonyms: TSH1; threonine synthase-like 1; threonine synthase like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgggaatcccgattcgaaaatttatctgtgcctctaatcagaaccatgttttgactgattttataaaaacaggacattatgatctaagggaaagaaaactagcacaaaccttttcaccgtcaatagatattctcaaatcttcaaacctagaacgacatttacacttgatggctaataaagatggacagctaatgacagaattatttaatcgattagaaagtcagcatcatttccagatagaaaaggctctagttgagaaacttcagcaggattttgtagctgactggtgctctgagggagagtgcctagcagctattaactccacctataatacttcagggtatattttggatccacacactgctgttgcaaaagtggttgcagatagggtgcaagacaaaacttgccctgtgattatctcatctacagcccattactcaaagtttgcacctgctatcatgcaggctttaaagattaaagaaatcaatgagacttcatcaagtcagctctatttgctgggttcatacaatgcattacctccactgcatgaggctttattagagagaacaaaacagcaagagaagatggagtaccaggtctgtgcagctgatatgaatgtcttgaagagtcatgtggaacaacttgtccaaaatcaattcatatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: