Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of SMNDC1-survival motor neuron domain containing 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SMNDC1-survival motor neuron domain containing 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011234 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SMNDC1 |
| Origin species: | Human |
| Product name: | SMNDC1-survival motor neuron domain containing 1 Gene |
| Size: | 2ug |
| Accessions: | BC011234 |
| Gene id: | 10285 |
| Gene description: | survival motor neuron domain containing 1 |
| Synonyms: | SMNR; SPF30; TDRD16C; survival of motor neuron-related-splicing factor 30; 30 kDa splicing factor SMNrp; SMN-related protein; splicing factor 30, survival of motor neuron-related; survival motor neuron domain-containing protein 1; tudor domain containing 16C; survival motor neuron domain containing 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcagaggatttagcaaagcagctggcaagctacaaagctcagctccagcaagttgaagctgcattatctggaaatggagaaaatgaagatttgctaaaattgaagaaagatttacaagaagttatagaactaaccaaagaccttctgtcaactcaaccttctgagacgcttgcaagttcagacagttttgcttctactcaacctactcattcatggaaagtaggagacaagtgtatggcagtctggagtgaagatggacagtgttatgaagcggagattgaggagatagatgaagaaaatggcaccgctgcaatcacctttgctggttatggcaatgctgaagtgactccactgttgaacctcaagcctgtagaagaaggaaggaaggcaaaggaggacagtggcaacaaacccatgtcaaaaaaagaaatgattgcccagcagcgtgaatataaaaagaagaaagctttgaaaaaagctcagagaataaaagaacttgagcaggaaagagaggaccagaaagtgaaatggcaacaattcaacaacagagcctattctaaaaacaaaaaaggccaggtaaagaggagtatttttgcttcacctgagagtgtgactggtaaagttggagtaggaacctgtggaattgctgataaacctatgacacaatatcaagatacctctaaatacaatgtcaggcatttgatgcctcaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - signal transducing adaptor family member 1 - potassium channel, subfamily K, member 17 - transmembrane protein 185B (pseudogene) - ubiquitin-like modifier activating enzyme 6 |