Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of MPV17-MpV17 mitochondrial inner membrane protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MPV17-MpV17 mitochondrial inner membrane protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001115 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MPV17 |
| Origin species: | Human |
| Product name: | MPV17-MpV17 mitochondrial inner membrane protein Gene |
| Size: | 2ug |
| Accessions: | BC001115 |
| Gene id: | 4358 |
| Gene description: | MpV17 mitochondrial inner membrane protein |
| Synonyms: | MPV17, mitochondrial inner membrane protein; Mpv17, human homolog of glomerulosclerosis and nephrotic syndrome; MpV17 mitochondrial inner membrane protein; protein Mpv17; MTDPS6; SYM1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcactctggcgggcataccagcgggccctggccgctcacccgtggaaagtacaggtcctgacagctgggtccctgatgggcctgggtgacattatctcacagcagctggtggagaggcggggtctgcaggaacaccagagaggccggactctgaccatggtgtccctgggctgtggctttgtgggccctgtggtaggaggctggtacaaggttttggatcggttcatccctggcaccaccaaagtggatgcactgaagaagatgttgttggatcaggggggctttgccccgtgttttctaggctgctttctcccactggtaggggcacttaatggactgtcagcccaggacaactgggccaaactacagcgggattatcctgatgcccttatcaccaactactatctatggcctgctgtgcagttagccaacttctacctggtcccccttcattacaggttggccgttgtccaatgtgttgctgttatctggaactcctacctgtcctggaaggcacatcggctctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RNA binding protein with multiple splicing - threonine synthase-like 1 (S. cerevisiae) - survival motor neuron domain containing 1 - signal transducing adaptor family member 1 |