MPV17-MpV17 mitochondrial inner membrane protein Gene View larger

MPV17-MpV17 mitochondrial inner membrane protein Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MPV17-MpV17 mitochondrial inner membrane protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MPV17-MpV17 mitochondrial inner membrane protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001115
Product type: DNA & cDNA
Ncbi symbol: MPV17
Origin species: Human
Product name: MPV17-MpV17 mitochondrial inner membrane protein Gene
Size: 2ug
Accessions: BC001115
Gene id: 4358
Gene description: MpV17 mitochondrial inner membrane protein
Synonyms: MPV17, mitochondrial inner membrane protein; Mpv17, human homolog of glomerulosclerosis and nephrotic syndrome; MpV17 mitochondrial inner membrane protein; protein Mpv17; MTDPS6; SYM1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcactctggcgggcataccagcgggccctggccgctcacccgtggaaagtacaggtcctgacagctgggtccctgatgggcctgggtgacattatctcacagcagctggtggagaggcggggtctgcaggaacaccagagaggccggactctgaccatggtgtccctgggctgtggctttgtgggccctgtggtaggaggctggtacaaggttttggatcggttcatccctggcaccaccaaagtggatgcactgaagaagatgttgttggatcaggggggctttgccccgtgttttctaggctgctttctcccactggtaggggcacttaatggactgtcagcccaggacaactgggccaaactacagcgggattatcctgatgcccttatcaccaactactatctatggcctgctgtgcagttagccaacttctacctggtcccccttcattacaggttggccgttgtccaatgtgttgctgttatctggaactcctacctgtcctggaaggcacatcggctctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RNA binding protein with multiple splicing
- threonine synthase-like 1 (S. cerevisiae)
- survival motor neuron domain containing 1
- signal transducing adaptor family member 1

Buy MPV17-MpV17 mitochondrial inner membrane protein Gene now

Add to cart