SYNGR2-synaptogyrin 2 Gene View larger

SYNGR2-synaptogyrin 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SYNGR2-synaptogyrin 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SYNGR2-synaptogyrin 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000407
Product type: DNA & cDNA
Ncbi symbol: SYNGR2
Origin species: Human
Product name: SYNGR2-synaptogyrin 2 Gene
Size: 2ug
Accessions: BC000407
Gene id: 9144
Gene description: synaptogyrin 2
Synonyms: synaptogyrin-2; cellugyrin; synaptogyrin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagagcggggcctacggcgcggccaaggcgggcggctccttcgacctgcggcgcttcctgacgcagccgcaggtggtggcgcgcgccgtgtgcttggtcttcgccttgatcgtgttctcctgcatctatggtgagggctacagcaatgcccacgagtctaagcagatgtactgcgtgttcaaccgcaacgaggatgcctgccgctatggcagtgccatcggggtgctggccttcctggcctcggccttcttcttggtggtcgacgcgtatttcccccagatcagcaacgccactgaccgcaagtacctggtcattggtgacctgctcttctcagctctctggaccttcctgtggtttgttggtttctgcttcctcaccaaccagtgggcagtcaccaacccgaaggacgtgctggtgggggccgactctgtgagggcagccatcaccttcagcttcttttccatcttctcctggggtgtgctggcctccctggcctaccagcgctacaaggctggcgtggacgacttcatccagaattacgttgaccccactccggaccccaacactgcctacgcctcctacccaggtgcatctgtggacaactaccaacagccacccttcacccagaacgcggagaccaccgagggctaccagccgccccctgtgtactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - neurexophilin 3
- peroxiredoxin 3
- ZW10 interactor
- cone-rod homeobox

Buy SYNGR2-synaptogyrin 2 Gene now

Add to cart