Login to display prices
Login to display prices
SYNGR2-synaptogyrin 2 Gene View larger

SYNGR2-synaptogyrin 2 Gene

PTXBC000407

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SYNGR2-synaptogyrin 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SYNGR2-synaptogyrin 2 Gene

Proteogenix catalog: PTXBC000407
Ncbi symbol: SYNGR2
Product name: SYNGR2-synaptogyrin 2 Gene
Size: 2ug
Accessions: BC000407
Gene id: 9144
Gene description: synaptogyrin 2
Synonyms: synaptogyrin-2; cellugyrin; synaptogyrin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagagcggggcctacggcgcggccaaggcgggcggctccttcgacctgcggcgcttcctgacgcagccgcaggtggtggcgcgcgccgtgtgcttggtcttcgccttgatcgtgttctcctgcatctatggtgagggctacagcaatgcccacgagtctaagcagatgtactgcgtgttcaaccgcaacgaggatgcctgccgctatggcagtgccatcggggtgctggccttcctggcctcggccttcttcttggtggtcgacgcgtatttcccccagatcagcaacgccactgaccgcaagtacctggtcattggtgacctgctcttctcagctctctggaccttcctgtggtttgttggtttctgcttcctcaccaaccagtgggcagtcaccaacccgaaggacgtgctggtgggggccgactctgtgagggcagccatcaccttcagcttcttttccatcttctcctggggtgtgctggcctccctggcctaccagcgctacaaggctggcgtggacgacttcatccagaattacgttgaccccactccggaccccaacactgcctacgcctcctacccaggtgcatctgtggacaactaccaacagccacccttcacccagaacgcggagaccaccgagggctaccagccgccccctgtgtactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: