Login to display prices
Login to display prices
ZWINT-ZW10 interactor Gene View larger

ZWINT-ZW10 interactor Gene

PTXBC020979

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZWINT-ZW10 interactor Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZWINT-ZW10 interactor Gene

Proteogenix catalog: PTXBC020979
Ncbi symbol: ZWINT
Product name: ZWINT-ZW10 interactor Gene
Size: 2ug
Accessions: BC020979
Gene id: 11130
Gene description: ZW10 interactor
Synonyms: zwint-1; HZwint-1; KNTC2AP; SIP30; ZWINT1; ZW10 interactor; SNAP25 interacting protein of 30 kDa; ZW10 interactor, kinetochore protein; human ZW10 interacting protein-1; ZW10 interacting kinetochore protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggcagcggagacagaggcggaagctgcagccctagaggtcctggctgaggtggcaggcatcttggaacctgtaggcctgcaggaggaggcagaactgccagccaagatcctggttgagtttgtggtggactctcagaagaaagacaagctgctctgcagccagcttcaggtagcggatttcctgcagaacatcctggctcaggaggacactgctaagggtctcgaccccttggcttctgaagacacgagccgacagaaggcaattgcagctaaggaacaatggaaagagctgaaggccacctacagggagcacgtagaggccatcaaaattggcctcaccaaggccctgactcagatggaggaagcccagaggaaacggacacaactccgggaagcctttgagcagctccaggccaagaaacaaatggccatggagaaacgcagagcagtccagaaccagtggcagctacaacaggagaagcatctgcagcatctggcggaggtttctgcagaggtgagggagcgtaagacagggactcagcaggagcttgacggggtgtttcagaaacttggaaacctgaagcagcaggcagaacaggagcgggacaagctgcagaggtatcagaccttcctccagcttctgtataccctgcagggtaagctgttgttccctgaggctgaggctgaggcagagaatcttccagatgataaaccccagcagccgactcgaccccaggagcagagtacaggagacaccatggggagagaccctggtgtgtccttcaaggctgttggtctacaacctgctggagatgtaaatttgccatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: