NXPH3-neurexophilin 3 Gene View larger

NXPH3-neurexophilin 3 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NXPH3-neurexophilin 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NXPH3-neurexophilin 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022541
Product type: DNA & cDNA
Ncbi symbol: NXPH3
Origin species: Human
Product name: NXPH3-neurexophilin 3 Gene
Size: 2ug
Accessions: BC022541
Gene id: 11248
Gene description: neurexophilin 3
Synonyms: NPH3; neurexophilin-3; neurexophilin 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaactgactcgctgctgcttcgtgttcctggtgcagggtagcctctatctggtcatctgtggccaggatgatggtcctcccggctcagaggaccctgagcgtgatgaccacgagggccagccccggccccgggtgcctcggaagcggggccacatctcacctaagtcacgccccatggccaattccactctcctagggctgctggccccgcctggggaggcttggggcattcttgggcagccccccaaccgcccgaaccacagccccccaccctcagccaaggtgaagaaaatctttggctggggcgacttctactccaacatcaagacggtggccctgaacctgctcgtcacagggaagattgtggaccatggcaatgggaccttcagcgtccacttccaacacaatgccacaggccagggaaacatctccatcagcctcgtgccccccagtaaagctgtagagttccaccaggaacagcagatcttcatcgaagccaaggcctccaaaatcttcaactgccggatggggtgggagaaggtagaacggggccgccggacctcgctttgcacccacgacccagccaagatctgctcccgagaccacgctcagagctcagccacctggagctgctcccagcccttcaaagtcgtctgtgtctacatcgccttctacagcacggactatcggctggtccagaaggtgtgcccagattacaactaccatagtgataccccctactacccatctgggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - peroxiredoxin 3
- ZW10 interactor
- cone-rod homeobox
- F-box protein 8

Buy NXPH3-neurexophilin 3 Gene now

Add to cart