Login to display prices
Login to display prices
TCN2-transcobalamin II, macrocytic anemia Gene View larger

TCN2-transcobalamin II, macrocytic anemia Gene

PTXBC011239

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TCN2-transcobalamin II, macrocytic anemia Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TCN2-transcobalamin II, macrocytic anemia Gene

Proteogenix catalog: PTXBC011239
Ncbi symbol: TCN2
Product name: TCN2-transcobalamin II, macrocytic anemia Gene
Size: 2ug
Accessions: BC011239
Gene id: 6948
Gene description: transcobalamin II; macrocytic anemia
Synonyms: D22S676; D22S750; TC II; TC-2; TC2; TCII; transcobalamin-2; macrocytic anemia; transcobalamin II; macrocytic anemia; vitamin B12-binding protein 2; transcobalamin 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggcaccttggggccttcctcttccttctgggggtcctgggggccctcactgagatgtgtgaaataccagagatggacagccatctggtagagaagttgggccagcacctcttaccttggatggaccggctttccctggagcacttgaaccccagcatctatgtgggcctacgcctctccagtctgcaggctgggaccaaggaagacctctacctgcacagcctcaagcttggttaccagcagtgcctcctagggtctgccttcagcgaggatgacggtgactgccagggcaagccttccatgggccagctggccctctacctgctcgctctcagagccaactggcatgatcacaagggccacccccacactagctactaccagtatggcctgggcattctggccctgtgtctccaccagaagcgggtccatgacagcgtggtggacaaacttctgtatgctgtggaacctttccaccagggccaccattctgtggacacagcagccatggcaggcttggcattcacctgtctgaagcgctcaaacttcaaccctggtcggagacaacggatcaccatggccatcagaacagtgcgagaggagatcttgaaggcccagacccccgagggccactttgggaatgtctacagcaccccattggcattacagttcctcatgacttcccccatgcgtggggcagaactgggaacagcatgtctcaaggcgagggttgctttgctggccagtctgcaggatggagccttccagaatgctctcatgatttcccagctgctgcccgttctgaaccacaagacctacattgatctgatcttcccagactgtctggcaccacgagtcatgttggaaccagctgctgagaccattcctcagacccaagagatcatcagtgtcacgctgcaggtgcttagtctcttgccgccgtacagacagtccatctctgttctggccgggtccaccgtggaagatgtcctgaagaaggcccatgagttaggaggattcacatatgaaacacaggcctccttgtcaggcccctacttaacctccgtgatggggaaagcggccggagaaagggagttctggcagcttctccgagaccccaacaccccactgttgcaaggtattgctgactacagacccaaggatggagaaaccattgagctgaggctggttagctggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: