LCAT-lecithin-cholesterol acyltransferase Gene View larger

LCAT-lecithin-cholesterol acyltransferase Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LCAT-lecithin-cholesterol acyltransferase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LCAT-lecithin-cholesterol acyltransferase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014781
Product type: DNA & cDNA
Ncbi symbol: LCAT
Origin species: Human
Product name: LCAT-lecithin-cholesterol acyltransferase Gene
Size: 2ug
Accessions: BC014781
Gene id: 3931
Gene description: lecithin-cholesterol acyltransferase
Synonyms: phosphatidylcholine-sterol acyltransferase; phosphatidylcholine--sterol O-acyltransferase; phospholipid-cholesterol acyltransferase; testicular secretory protein Li 24; lecithin-cholesterol acyltransferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggccgcccggctccccatggcagtgggtgacgctgctgctggggctgctgctccctcctgccgcccccttctggctcctcaatgtgctcttccccccgcacaccacgcccaaggctgagctcagtaaccacacacggcccgtcatcctcgtgcccggctgcctggggaatcagctagaagccaagctggacaaaccagatgtggtgaactggatgtgctaccgcaagacagaggacttcttcaccatctggctggatctcaacatgttcctaccccttggggtagactgctggatcgataacaccagggttgtctacaaccggagctctgggctcgtgtccaacgcccctggtgtccagatccgcgtccctggctttggcaagacctactctgtggagtacctggacagcagcaagctggcagggtacctgcacacactggtgcagaacctggtcaacaatggctacgtgcgggacgagactgtgcgcgccgccccctatgactggcggctggagcccggccagcaggaggagtactaccgcaagctcgcagggctggtggaggagatgcacgctgcctatgggaagcctgtcttcctcattggccacagcctcggctgtctacacttgctctatttcctgctgcgccagccccaggcctggaaggaccgctttattgatggcttcatctctcttggggctccctggggtggctccatcaagcccatgctggtcttggcctcaggtgacaaccagggcatccccatcatgtccagcatcaagctgaaagaggagcagcgcataaccaccacctccccctggatgtttccctctcgcatggcgtggcctgaggaccacgtgttcatttccacacccagcttcaactacacaggccgtgacttccaacgcttctttgcagacctgcactttgaggaaggctggtacatgtggctgcagtcacgtgacctcctggcaggactcccagcacctggtgtggaagtatactgtctttacggcgtgggcctgcccacgccccgcacctacatctacgaccacggcttcccctacacggaccctgtgggtgtgctctatgaggatggtgatgacacggtggcgacccgcagcaccgagctctgtggcctgtggcagggccgccagccacagcctgtgcacctgctgcccctgcacgggatacagcatctcaacatggtcttcagcaacctgaccctggagcacatcaatgccatcctgctgggtgcctaccgccagggtccccctgcatccccgactgccagcccagagcccccgcctcctgaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - limb region 1 homolog (mouse)-like
- limb region 1 homolog (mouse)-like
- coronin, actin binding protein, 2A
- acyl-CoA synthetase family member 2

Buy LCAT-lecithin-cholesterol acyltransferase Gene now

Add to cart