Login to display prices
Login to display prices
LMBR1L-limb region 1 homolog (mouse)-like Gene View larger

LMBR1L-limb region 1 homolog (mouse)-like Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LMBR1L-limb region 1 homolog (mouse)-like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LMBR1L-limb region 1 homolog (mouse)-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015015
Product type: DNA & cDNA
Ncbi symbol: LMBR1L
Origin species: Human
Product name: LMBR1L-limb region 1 homolog (mouse)-like Gene
Size: 2ug
Accessions: BC015015
Gene id: 55716
Gene description: limb region 1 homolog (mouse)-like
Synonyms: protein LMBR1L; LIMR; limb region 1 homolog-like; limb region 1 protein homolog-like; limb region 1-like protein -like; lipocalin-1 interacting membrane receptor; lipocalin-interacting membrane receptor; limb development membrane protein 1 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagcacctgactacgaagtgctatccgtgcgagaacagctattccacgagaggatccgcgagtgtattatatcaacacttctgtttgcaacactgtacatcctctgccacatcttcctgacccgcttcaagaagcctgctgagttcaccacagtggatgatgaagatgccaccgtcaacaagattgcgctcgagctgtgcacctttaccctggcaattgccctgggtgctgtcctgctcctgcccttctccatcatcagcaatgaggtgctgctctccctgcctcggaactactacatccagtggctcaacggctccctcatccatggcctctggaaccttgtttttctcttctccaacctgtccctcatcttcctcatgccctttgcatatttcttcactgagtctgagggctttgctggctccagaaagggtgtcctgggccgggtctatgagacagtggtgatgttgatgctcctcactctgctggtgctaggtatggtgtgggtggcatcagccattgtggacaagaacaaggccaacagagagtcactctatgacttttgggagtactatctcccctacctctactcatgcatctccttccttggggttctgctgctcctggtgtgtactccactgggtctcgcccgcatgttctccgtcactgggaagctgctagtcaagccccggctgctggaagacctggaggagcagctgtactgctcagcctttgaggaggcagccctgacccgcaggatctgtaatcctacttcctgctggctgcctttagacatggagctgctacacagacaggtcctggctctgcagacacagagggtcctgctggagaagaggcggaaggcttcagcctggcaacggaacctgggctaccccctggctatgctgtgcttgctggtgctgacgggcctgtctgttctcattgtggccatccacatcctggagctgctcatcgatgaggctgccatgccccgaggcatgcagggtacctccttaggccaggtctccttctccaagctgggctcctttggtgccgtcattcaggttgtactcatcttttacctaatggtgtcctcagttgtgggcttctatagctctccactcttccggagcctgcggcccagatggcacgacactgccatgacgcagataattgggaactgtgtctgtctcctggtcctaagctcagcacttcctgtcttctctcgaaccctggggctcactcgctttgacctgctgggtgactttggacgcttcaactggctgggcaatttctacattgtgttcctctacaacgcagcctttgcaggcctcaccacactctgtctggtgaagaccttcactgcagctgtgcgggcagagctgatccgggcctttgggctggacagactgccgctgcccgtctccggtttcccccaggcatctaggaagacccagcaccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coronin, actin binding protein, 2A
- acyl-CoA synthetase family member 2
- GTF2I repeat domain containing 1
- Mdm1 nuclear protein homolog (mouse)