PRIM1-primase, DNA, polypeptide 1 (49kDa) Gene View larger

PRIM1-primase, DNA, polypeptide 1 (49kDa) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRIM1-primase, DNA, polypeptide 1 (49kDa) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PRIM1-primase, DNA, polypeptide 1 (49kDa) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005266
Product type: DNA & cDNA
Ncbi symbol: PRIM1
Origin species: Human
Product name: PRIM1-primase, DNA, polypeptide 1 (49kDa) Gene
Size: 2ug
Accessions: BC005266
Gene id: 5557
Gene description: primase, DNA, polypeptide 1 (49kDa)
Synonyms: p49; DNA primase small subunit; DNA primase 1; DNA primase 49 kDa subunit; DNA primase subunit 48; primase p49 subunit; primase polypeptide 1, 49kDa; primase, DNA, polypeptide 1 (49kDa); primase (DNA) subunit 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagacgtttgaccccaccgagctgcccgagctgcttaaactttattaccggaggctctttccctactctcagtactatcgctggctcaactacggtggagtgataaagaattactttcaacaccgtgaattttcattcacattgaaagatgatatttacattcgctaccaatccttcaacaaccagagtgatctggaaaaggagatgcagaaaatgaatccatacaagattgatataggcgcagtatattctcacagacccaatcaacacaatacagtgaagctgggagctttccaggctcaggaaaaagaactggtatttgacattgacatgacagactatgacgatgtgaggagatgttgtagttctgcagacatatgtcctaagtgctggaccctcatgacaatggccatacgcatcattgacagagcattgaaggaggactttggatttaagcatcgtctctgggtatattctggaaggagaggtgttcattgttgggtctgtgatgaatcagttagaaaactgtcttctgcagtacgttctgggatagttgagtatttgagccttgtaaagggtggtcaagacgttaaaaagaaagttcacctaagtgaaaaaattcacccttttatcagaaaatctataaacataataaaaaaatactttgaagaatatgccttggttaatcaagatattctcgaaaataaagaaagctgggataagattttagcccttgttcctgaaacaattcatgatgaacttcaacaaagcttccaaaagtctcacaattcacttcagcgttgggagcacttgaagaaagtagccagcagatatcagaataacatcaaaaatgacaaatatggaccctggctggagtgggagattatgctccagtactgttttccacggctggatatcaatgtcagcaaaggaatcaatcatctactgaagagcccttttagtgttcatcctaaaacaggtcgcatatctgtgcctattgatttgcagaaagtggaccagtttgatccatttactgttccgaccataagcttcatctgccgtgaattggatgccatttccactaatgaagaggaaaaagaggagaatgaagctgaatctgatgtcaaacatagaaccagagattataagaagaccagtctagcaccttatgtgaaagtttttgaacattttcttgaaaatctggataaatcccgaaaaggagaacttcttaagaagagtgatttacaaaaagatttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - lecithin-cholesterol acyltransferase
- limb region 1 homolog (mouse)-like
- limb region 1 homolog (mouse)-like
- coronin, actin binding protein, 2A

Buy PRIM1-primase, DNA, polypeptide 1 (49kDa) Gene now

Add to cart