ARAP3-ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3 Gene View larger

ARAP3-ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARAP3-ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ARAP3-ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009968
Product type: DNA & cDNA
Ncbi symbol: ARAP3
Origin species: Human
Product name: ARAP3-ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3 Gene
Size: 2ug
Accessions: BC009968
Gene id: 64411
Gene description: ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
Synonyms: CENTD3; DRAG1; arf-GAP with Rho-GAP domain, ANK repeat and PH domain-containing protein 3; ARF-GAP, RHO-GAP, ankyrin repeat and plekstrin homology domains-containing protein 3; Arf and Rho GAP adapter protein 3; PtdIns(3,4,5)P3-binding protein; centaurin-delta-3; phosphoinositide binding protein; ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaatgtgggattggaccaccagcatccttaaagcccagcacgatgaccagcagccagtggtcttacgacgccattcctcctctgaccttgcccgtcagaagtttggcactatgcctttgctgcctatccgtggggatgacagtggagccaccctcctctctgccaatcagaccctgcggcgactacacaaccggaggaccctgtccatgttctttccaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - receptor (G protein-coupled) activity modifying protein 1
- ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast)
- myosin, light chain 3, alkali; ventricular, skeletal, slow
- transmembrane emp24 protein transport domain containing 1

Buy ARAP3-ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3 Gene now

Add to cart