MYL3-myosin, light chain 3, alkali, ventricular, skeletal, slow Gene View larger

MYL3-myosin, light chain 3, alkali, ventricular, skeletal, slow Gene

PTXBC009790

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MYL3-myosin, light chain 3, alkali, ventricular, skeletal, slow Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MYL3-myosin, light chain 3, alkali, ventricular, skeletal, slow Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009790
Product type: DNA & cDNA
Ncbi symbol: MYL3
Origin species: Human
Product name: MYL3-myosin, light chain 3, alkali, ventricular, skeletal, slow Gene
Size: 2ug
Accessions: BC009790
Gene id: 4634
Gene description: myosin, light chain 3, alkali; ventricular, skeletal, slow
Synonyms: CMH8; MLC-lV/sb; MLC1SB; MLC1V; VLC1; VLCl; myosin light chain 3; CMLC1; cardiac myosin light chain 1; myosin light chain 1, slow-twitch muscle B/ventricular isoform; myosin, light chain 3, alkali; ventricular, skeletal, slow; myosin, light polypeptide 3, alkali; ventricular, skeletal, slow; ventricular myosin alkali light chain; ventricular myosin light chain 1; ventricular/slow twitch myosin alkali light chain
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccccaaaaagccagagcccaagaaggatgatgccaaggcagcccccaaggcagctccagctcccgcacctccccctgagcctgagcgccctaaggaggtcgagtttgatgcttccaagatcaagattgagttcacacctgagcagattgaagagttcaaggaagccttcatgctgttcgaccgcacacccaagtgtgagatgaagatcacctacgggcagtgtggggatgtcctgcgggcgctgggccagaaccccacacaggcagaagtgctccgtgtcctggggaagccaagacaggaagagctcaataccaagatgatggactttgaaactttcctgcctatgctccagcacatttccaagaacaaggacacaggcacctatgaggacttcgtggaggggctgcgggtcttcgacaaggagggcaatggcactgtcatgggtgctgagcttcgccacgtgctggccacgctgggtgagaggctgacagaagacgaagtggagaagttgatggctgggcaagaggactccaatggctgcatcaactatgaagcatttgtgaagcacatcatgtccagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane emp24 protein transport domain containing 1
- brain-enriched guanylate kinase-associated homolog (rat)
- polymerase (RNA) III (DNA directed) polypeptide E (80kD)
- PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae)

Buy MYL3-myosin, light chain 3, alkali, ventricular, skeletal, slow Gene now

Add to cart