Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
RAMP1-receptor (G protein-coupled) activity modifying protein 1 Gene
PTXBC000548
New product
Data sheet of RAMP1-receptor (G protein-coupled) activity modifying protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RAMP1-receptor (G protein-coupled) activity modifying protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000548 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RAMP1 |
| Origin species: | Human |
| Product name: | RAMP1-receptor (G protein-coupled) activity modifying protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC000548 |
| Gene id: | 10267 |
| Gene description: | receptor (G protein-coupled) activity modifying protein 1 |
| Synonyms: | receptor activity-modifying protein 1; CRLR activity-modifying protein 1; calcitonin receptor-like receptor activity modifying protein 1; receptor (G protein-coupled) activity modifying protein 1; receptor (calcitonin) activity modifying protein 1; receptor activity modifying protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcccgggccctgtgccgcctcccgcggcgcggcctctggctgctcctggcccatcacctcttcatgaccactgcctgccaggaggctaactacggtgccctcctccgggagctctgcctcacccagttccaggtagacatggaggccgtcggggagacgctgtggtgtgactggggcaggaccatcaggagctacagggagctggccgactgcacctggcacatggcggagaagctgggctgcttctggcccaatgcagaggtggacaggttcttcctggcagtgcatggccgctacttcaggagctgccccatctcaggcagggccgtgcgggacccgcccggcagcatcctctaccccttcatcgtggtccccatcacggtgaccctgctggtgacggcactggtggtctggcagagcaagcgcactgagggcattgtgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast) - myosin, light chain 3, alkali; ventricular, skeletal, slow - transmembrane emp24 protein transport domain containing 1 - brain-enriched guanylate kinase-associated homolog (rat) |