Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
UBE2G2-ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast) Gene
PTXBC001738
New product
Data sheet of UBE2G2-ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UBE2G2-ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001738 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UBE2G2 |
| Origin species: | Human |
| Product name: | UBE2G2-ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast) Gene |
| Size: | 2ug |
| Accessions: | BC001738 |
| Gene id: | 7327 |
| Gene description: | ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast) |
| Synonyms: | UBC7; ubiquitin-conjugating enzyme E2 G2; E2 ubiquitin-conjugating enzyme G2; ubiquitin carrier protein G2; ubiquitin conjugating enzyme 7; ubiquitin conjugating enzyme E2G 2; ubiquitin conjugating enzyme G2; ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast); ubiquitin-conjugating enzyme E2G 2 (homologous to yeast UBC7); ubiquitin-protein ligase G2; ubiquitin conjugating enzyme E2 G2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggggaccgcgctcaagaggctgatggccgagtacaaacaattaacactgaatcctccggaaggaattgtagcaggccccatgaatgaagagaacttttttgaatgggaggcattgatcatgggcccagaagacacctgctttgagtttggtgtttttcctgccatcctgagtttcccacttgattacccgttaagtcccccaaagatgagatttacctgtgagatgtttcatcccaacatctaccctgatgggagagtctgcatttccatcctccacgcgccaggcgatgaccccatgggctacgagagcagcgcggagcggtggagtcctgtgcagagtgtggagaagatcctgctgtcggtggtgagcatgctggcagagcccaatgacgaaagtggagctaacgtggatgcgtccaaaatgtggcgcgatgaccgggagcagttctataagattgccaagcagatcgtccagaagtctctgggactgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - myosin, light chain 3, alkali; ventricular, skeletal, slow - transmembrane emp24 protein transport domain containing 1 - brain-enriched guanylate kinase-associated homolog (rat) - polymerase (RNA) III (DNA directed) polypeptide E (80kD) |