Login to display prices
Login to display prices
UBE2G2-ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast) Gene View larger

UBE2G2-ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast) Gene

PTXBC001738

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBE2G2-ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UBE2G2-ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001738
Product type: DNA & cDNA
Ncbi symbol: UBE2G2
Origin species: Human
Product name: UBE2G2-ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast) Gene
Size: 2ug
Accessions: BC001738
Gene id: 7327
Gene description: ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast)
Synonyms: UBC7; ubiquitin-conjugating enzyme E2 G2; E2 ubiquitin-conjugating enzyme G2; ubiquitin carrier protein G2; ubiquitin conjugating enzyme 7; ubiquitin conjugating enzyme E2G 2; ubiquitin conjugating enzyme G2; ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast); ubiquitin-conjugating enzyme E2G 2 (homologous to yeast UBC7); ubiquitin-protein ligase G2; ubiquitin conjugating enzyme E2 G2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggggaccgcgctcaagaggctgatggccgagtacaaacaattaacactgaatcctccggaaggaattgtagcaggccccatgaatgaagagaacttttttgaatgggaggcattgatcatgggcccagaagacacctgctttgagtttggtgtttttcctgccatcctgagtttcccacttgattacccgttaagtcccccaaagatgagatttacctgtgagatgtttcatcccaacatctaccctgatgggagagtctgcatttccatcctccacgcgccaggcgatgaccccatgggctacgagagcagcgcggagcggtggagtcctgtgcagagtgtggagaagatcctgctgtcggtggtgagcatgctggcagagcccaatgacgaaagtggagctaacgtggatgcgtccaaaatgtggcgcgatgaccgggagcagttctataagattgccaagcagatcgtccagaagtctctgggactgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - myosin, light chain 3, alkali; ventricular, skeletal, slow
- transmembrane emp24 protein transport domain containing 1
- brain-enriched guanylate kinase-associated homolog (rat)
- polymerase (RNA) III (DNA directed) polypeptide E (80kD)