PARL-presenilin associated, rhomboid-like Gene View larger

PARL-presenilin associated, rhomboid-like Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PARL-presenilin associated, rhomboid-like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PARL-presenilin associated, rhomboid-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014058
Product type: DNA & cDNA
Ncbi symbol: PARL
Origin species: Human
Product name: PARL-presenilin associated, rhomboid-like Gene
Size: 2ug
Accessions: BC014058
Gene id: 55486
Gene description: presenilin associated, rhomboid-like
Synonyms: mitochondrial intramembrane-cleaving protease PARL; PRO2207; PSARL; PSARL1; PSENIP2; RHBDS1; presenilins-associated rhomboid-like protein, mitochondrial; rhomboid 7 homolog 1; presenilin associated rhomboid like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtggcgaggctgggcgcagagaggctggggctgcggccaggcgtggggtgcgtcggtgggcggccgcagctgcgaggagctcactgcggtcctaaccccgccgcagctcctcggacgcaggtttaacttctttattcaacaaaaatgcggattcagaaaagcacccaggaaggttgaacctcgaagatcagacccagggacaagtggtgaagcatacaagagaagtgctttgattcctcctgtggaagaaacagtcttttatccttctccctatcctataaggagtctcataaaacctttattttttactgttgggtttacaggctgtgcatttggatcagctgctatttggcaatatgaatcactgaaatccagggtccagagttattttgatggtataaaagctgattggttggatagcataagaccacaaaaagaaggagacttcagaaaggagattaacaagtggtggaataacctaagtgatggccagcggactgtgacaggtattatagctgcaaatgtccttgtattctgtttatggagagtaccttctctgcagcggacaatgatcagatatttcacatcgaatccagcctcaaaggtcctttgttctccaatgttgctgtcaacattcagtcatttctccttatttcacatggcagcaaatatgtatgttttgtggagcttctcttccagcatagtgaacattctgggtcaagagcagttcatggcagtgtacctatctgcaggtgttatttccaattttgtcagttacgtgggtaaagttgccacaggaagatatggaccatcacttggtgcatctggtgccatcatgacagtcctcgcagctgtctgcactaagatcccagaagggaggcttgccattattttccttccgatgttcacgttcacagcagggaatgccctgaaagccattatcgccatggatacagcaggaatgatcctgggatggaaattttttgatcatgcggcacatcttgggggagctctttttggaatatggtatgttacttacggtcatgaactgatttggaagaacagggagccgctagtgaaaatctggcatgaaataaggactaatggccccaaaaaaggaggtggctctaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transcobalamin II; macrocytic anemia
- primase, DNA, polypeptide 1 (49kDa)
- lecithin-cholesterol acyltransferase
- limb region 1 homolog (mouse)-like

Buy PARL-presenilin associated, rhomboid-like Gene now

Add to cart