Login to display prices
Login to display prices
ZPBP-zona pellucida binding protein Gene View larger

ZPBP-zona pellucida binding protein Gene

PTXBC005223

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZPBP-zona pellucida binding protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZPBP-zona pellucida binding protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005223
Product type: DNA & cDNA
Ncbi symbol: ZPBP
Origin species: Human
Product name: ZPBP-zona pellucida binding protein Gene
Size: 2ug
Accessions: BC005223
Gene id: 11055
Gene description: zona pellucida binding protein
Synonyms: ZPBP1; zona pellucida-binding protein 1; inner acrosomal membrane IAM38; zona pellucida binding protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggccttcgcccttggcccagcgcggcggggcaggcggcggacccgggccgccggctccctgctctctcgggccgccatcctcctctttatctccgccttcctggtgcgggtgccctcatcagttggacacttggttcgattaccaagagcttttcgcttgaccaaagattcagtgaaaatagtgggatcaacaagttttccagtgaaagcgtatgtcatgctccatcaaaagagtccacacgtgttatgtgtaacgcaacaactgcgaaatgctgaactgatagacccatcattccaatggtatgggcctaaaggaaaagttgtttcagtagaaaaccgcactgcacaaataacatccacaggaagccttgtattccaaaattttgaggagagtatgagtggaatttatacatgtttcctcgaatataaacctactgtggaagaaattgttaaacgtcttcaactaaaatatgctatatatgcttatcgtgagcctcattattattatcagttcacagctcgatatcatgcagctccctgcaatagcatttataatatttcttttgagaagaaacttcttcagattttaagcaaactgcttcttgacctttcatgtgaaatttccttacttaagtctgaatgccatcgcgttaaaatgcaaagagctggtttgcaaaatgaattgttctttgcattttcagtttcatctctagacactgaaaaaggacccaagcgatgtacagaccataactgtgaaccttacaaaagactttttaaggctaaaaatctcatagagagattttttaatcaacaagtagaaattcttggcagacgtgcagaacaattacctcaaatatactatattgaaggtactctccaaatggtttggattaatcgctgctttccaggatatggaatgaatgtccagcaacatccaaaatgtcctgagtgctgtgtgatctgcagccctggatcatataacccccgtgatggaattcattgccttcaatgcaatagcagcctggtgtatggagcaaaaacgtgcttataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - homer homolog 1 (Drosophila)
- transmembrane protein 183A
- armadillo repeat containing 8
- argininosuccinate synthetase 1