HOMER1-homer homolog 1 (Drosophila) Gene View larger

HOMER1-homer homolog 1 (Drosophila) Gene

PTXBC015502

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HOMER1-homer homolog 1 (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HOMER1-homer homolog 1 (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015502
Product type: DNA & cDNA
Ncbi symbol: HOMER1
Origin species: Human
Product name: HOMER1-homer homolog 1 (Drosophila) Gene
Size: 2ug
Accessions: BC015502
Gene id: 9456
Gene description: homer homolog 1 (Drosophila)
Synonyms: HOMER; HOMER1A; HOMER1B; HOMER1C; SYN47; Ves-1; homer protein homolog 1; homer homolog 1; homer, neuronal immediate early gene, 1; homer-1; homer scaffolding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggggaacaacctatcttcagcactcgagctcatgtcttccaaattgacccaaacacaaagaagaactgggtacccaccagcaagcatgcagttactgtgtcttatttctatgacagcacaagaaatgtgtataggataatcagtttagatggctcaaaggcaataataaatagtaccatcaccccaaacatgacatttactaaaacatctcagaagtttggccagtgggctgatagccgggcaaacaccgtttatggattgggattctcctctgagcatcatctttcgaaatttgcagaaaagtttcaggaatttaaagaagctgctcgactagcaaaggaaaaatcacaagagaagatggaacttaccagtacaccttcacaggaatccgcaggcggggatcttcagtctcctttaacaccggaaagtatcaacgggacagatgatgaaagaacacctgatgtgacacagaactcagagccaagggctgaaccaactcagaatgcattgccattttcacatagttcagcaatcagcaaacattgggaggctgaactggctaccctcaaaggaaataatgccaaactcactgcagccctgctggagtccactgccaatgtgaaacaatggaaacagcaacttgctgcctatcaagaggaagcagaacgtctgcacaagcgggtgactgaacttgaatgtgttagtagccaagcaaatgcagtacatactcataagacagaattaaatcagacaatacaagaactggaagagacactgaaactgaaggaagaggaaatagaaaggttaaaacaagaaattgataatgccagagaactacaagaacagagggattctttgactcagaaactacaggaagtagaaattcggaacaaagacctggagggacaactgtctgacttagagcaacgtctggagaaaagtcagaatgaacaagaagcttttcgcaataacctgaagacactcttagaaattctggatggaaagatatttgaactaacagaattacgagataacttggccaagctactagaatgcagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 183A
- armadillo repeat containing 8
- argininosuccinate synthetase 1
- arrestin domain containing 3

Buy HOMER1-homer homolog 1 (Drosophila) Gene now

Add to cart