Login to display prices
Login to display prices
PNKD-paroxysmal nonkinesigenic dyskinesia Gene View larger

PNKD-paroxysmal nonkinesigenic dyskinesia Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PNKD-paroxysmal nonkinesigenic dyskinesia Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PNKD-paroxysmal nonkinesigenic dyskinesia Gene

Proteogenix catalog: PTXBC002937
Ncbi symbol: PNKD
Product name: PNKD-paroxysmal nonkinesigenic dyskinesia Gene
Size: 2ug
Accessions: BC002937
Gene id: 25953
Gene description: paroxysmal nonkinesigenic dyskinesia
Synonyms: BRP17; DYT8; FKSG19; FPD1; KIPP1184; MR-1; MR1; PDC; PKND1; TAHCCP2; brain protein 17; myofibrillogenesis regulator 1; trans-activated by hepatitis C virus core protein 2; paroxysmal nonkinesigenic dyskinesia
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttggcagggctggcccgcggcgtggcagtgggtcgccggctgctggctcctcctcgtccttgtcctcgtcctacttgtgagcccccgcggctgccgagcgcggcggggcctccgcggtctgctcatggcgcacagccagcggctgctcttccgaatcgggtacagcctgtacacccgcacctggctcgggtacctcttctaccgacagcagctgcgcagggctcggaatcgctaccctaaaggccactcgaaaacccagccccgcctcttcaatggagtgaaggtgcttcccatccctgtcctctcggacaactacagctacctcatcatcgacacccaggcccagctggctgtggctgtggacccttcagaccctcgggctgtgcaggcttccattgaaaaggaaggggtcaccttggtcgccattctgtgtactcacaagcactgggaccacagtggagggaaccgtgacctcagccggcggcaccgggactgtcgggtgtacgggagccctcaggacggcatcccctacctcacccatcccctgtgtcatcaagatgtggtcagcgtgggacggcttcagatccgggccctggctacacctggccacacacaaggccatctggtctacctactggatggggagccctacaagggtccctcctgcctcttctcaggggacctgctcttcctctctggctgtgggcggacctttgagggcaatgcagagaccatgctgagctcactggacactgtgctggggctaggggatgacacccttctgtggcctggtcatgagtatgcagaggagaacctgggctttgcaggtgtggtggagcccgagaacctggcccgggagaggaagatgcagtgggtgcagcggcagcggctggagcgcaagggcacgtgcccatctaccctgggagaggagcgctcctacaacccgttcctgagaacccactgcctggcgctacaggaggctctggggccggggccgggccccactggggatgatgactactcccgggcccagctcctggaagagctccgccggctgaaggatatgcacaagagcaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: