Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of HCST-hematopoietic cell signal transducer Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HCST-hematopoietic cell signal transducer Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC035931 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HCST |
| Origin species: | Human |
| Product name: | HCST-hematopoietic cell signal transducer Gene |
| Size: | 2ug |
| Accessions: | BC035931 |
| Gene id: | 10870 |
| Gene description: | hematopoietic cell signal transducer |
| Synonyms: | KAP10; PIK3AP; hematopoietic cell signal transducer; DNAX-activation protein 10; kinase assoc pro of ~10kDa; kinase assoc protein; membrane protein DAP10; phosphoinositide-3-kinase adaptor protein; transmembrane adapter protein KAP10 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatccatctgggtcacatcctcttcctgcttttgctcccagtggctgcagctcagacgactccaggagagagatcatcactccctgccttttaccctggcacttcaggctcttgttccggatgtgggtccctctctctgccgctcctggcaggcctcgtggctgctgatgcggtggcatcgctgctcatcgtgggggcggtgttcctgtgcgcacgcccacgccgcagccccgcccaagaagatggcaaagtctacatcaacatgccaggcaggggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - coiled-coil domain containing 117 - Rho GTPase activating protein 28 - inhibitor of growth family, member 3 - spermatogenesis associated 2-like |