Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of SPATA2L-spermatogenesis associated 2-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPATA2L-spermatogenesis associated 2-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC027606 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPATA2L |
| Origin species: | Human |
| Product name: | SPATA2L-spermatogenesis associated 2-like Gene |
| Size: | 2ug |
| Accessions: | BC027606 |
| Gene id: | 124044 |
| Gene description: | spermatogenesis associated 2-like |
| Synonyms: | C16orf76; tamo; spermatogenesis-associated protein 2-like protein; SPATA2-like protein; spermatogenesis associated 2 like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcagcagctcgctgtccgaggactaccgccagtgcctggagcgcgagctgcgacggggccgcgcgggcgtgtgcggggacccctcgctgcgcgcggtgctctggcagatcctggtggaggacttcgacctgcacggggcgctgcaggacgacgcgctggctctgctcaccgacgggctgtggggccgcgccgacctggcgcccgcgctacgcggcctggctcgcgccttcgagcttctggagctcgccgcggtgcacctgtacctgctgccctggaggaaggagttcaccaccatcaagaccttctctgggggctacgtgcacgtgctgaagggtgtgctctcagacgacctcctcctgaagagcttccagaagatgggctacgtacgcagagacagccatcggctcatgctctgctggagccaatctgcggggctctgccgggtgcacggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - regulator of G-protein signaling 22 - phosphatase and actin regulator 4 - coiled-coil domain containing 28B - guanidinoacetate N-methyltransferase |