Login to display prices
Login to display prices
CLN6-ceroid-lipofuscinosis, neuronal 6, late infantile, variant Gene View larger

CLN6-ceroid-lipofuscinosis, neuronal 6, late infantile, variant Gene

PTXBC010849

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CLN6-ceroid-lipofuscinosis, neuronal 6, late infantile, variant Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CLN6-ceroid-lipofuscinosis, neuronal 6, late infantile, variant Gene

Proteogenix catalog: PTXBC010849
Ncbi symbol: CLN6
Product name: CLN6-ceroid-lipofuscinosis, neuronal 6, late infantile, variant Gene
Size: 2ug
Accessions: BC010849
Gene id: 54982
Gene description: ceroid-lipofuscinosis, neuronal 6, late infantile, variant
Synonyms: CLN4A; HsT18960; nclf; ceroid-lipofuscinosis neuronal protein 6; ceroid-lipofuscinosis neuronal 6 late infantile; ceroid-lipofuscinosis, neuronal 6, late infantile, variant
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggcgacgcggaggcggcagcacctgggagcgacgggcggcccaggcgcgcagctgggcgcctccttcctgcaggccaggcatggctctgtgagcgctgatgaggctgcccgcacggctcccttccacctcgacctctggttctacttcacactgcagaactgggttctggactttgggcgtcccattgccatgctggtattccctctcgagtggtttccactcaacaagcccagtgttggggactacttccacatggcctacaacgtcatcacgccctttctcttgctcaagctcatcgagcggtccccccgcaccctgccacgctccatcacgtacgtgagcatcatcatcttcatcatgggtgccagcatccacctggtgggtgactctgtcaaccaccgcctgctcttcagtggctaccagcaccacctgtctgtccgtgagaaccccatcatcaagaatctcaagccggagacgctgatcgactcctttgagctgctctactattatgatgagtacctgggtcactgcatgtggtacatccccttcttcctcatcctcttcatgtacttcagcggctgctttactgcctctaaagctgagagcttgattccagggcctgccctgctcctggtggcacccagtggcctgtactactggtacctggtcaccgagggccagatcttcatcctcttcatcttcaccttcttcgccatgctggccctcgtcctgcaccagaagcgcaagcgcctcttcctggacagcaacggcctcttcctcttctcctccttcgcactgaccctcttgcttgtggcgctctgggtcgcctggctgtggaatgaccctgttctcaggaagaagtacccgggtgtcatctacgtccctgagccctgggctttctacacccttcacgtcagcagtcggcactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: