Login to display prices
Login to display prices
POLR3D-polymerase (RNA) III (DNA directed) polypeptide D, 44kDa Gene View larger

POLR3D-polymerase (RNA) III (DNA directed) polypeptide D, 44kDa Gene

PTXBC002603

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of POLR3D-polymerase (RNA) III (DNA directed) polypeptide D, 44kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about POLR3D-polymerase (RNA) III (DNA directed) polypeptide D, 44kDa Gene

Proteogenix catalog: PTXBC002603
Ncbi symbol: POLR3D
Product name: POLR3D-polymerase (RNA) III (DNA directed) polypeptide D, 44kDa Gene
Size: 2ug
Accessions: BC002603
Gene id: 661
Gene description: polymerase (RNA) III (DNA directed) polypeptide D, 44kDa
Synonyms: BN51T; RPC4; RPC53; TSBN51; DNA-directed RNA polymerase III subunit RPC4; BN51 (BHK21) temperature sensitivity complementing; DNA-directed RNA polymerase III 47 kDa polypeptide; DNA-directed RNA polymerase III subunit D; RNA polymerase III 47 kDa subunit; RNA polymerase III subunit C4; RPC53 homolog; polymerase (RNA) III (DNA directed) polypeptide D, 44kDa; polymerase (RNA) III subunit D; temperature sensitive complementation, cell cycle specific, tsBN51; RNA polymerase III subunit D
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggaaggaaacgccgccggcgagcccagcacgccgggagggccccgacctctcctgactggggcccgggggctcatcgggcggcggccggcgcctcccctcacccccggccgccttccctccatccgttccagggacctcaccctcgggggagtcaagaagaaaaccttcaccccaaatatcatcagtcggaagatcaaggaagagcccaaggaagaagtaactgtcaagaaggagaagcgtgaaagggacagagaccgacaacgagaggggcatggacgagggcgaggccgtccagaagtgatccagtctcactccatctttgagcagggcccagccgaaatgatgaagaaaaaagggaactgggataagacagtggatgtgtcagacatgggaccttctcatatcatcaacatcaaaaaagagaagagagagacagacgaagaaactaaacagatcttgcgtatgctggagaaggacgatttcctcgatgaccccggcctgaggaacgacactcgaaatatgcctgtgcagctgccgctggctcactcaggatggctttttaaggaagaaaatgacgaaccagatgttaaaccttggctggctggccccaaggaagaggacatggaggtggacatacctgctgtgaaagtgaaagaggagccacgagatgaggaggaagaggccaagatgaaggctcctcccaaagcagccaggaagactccaggcctcccgaaggatgtatctgtggcagagctgctgagggagctgagcctcaccaaggaagaggaactgctgtttctgcagctgccagacaccctccctggccagccacccacccaggacatcaagcctatcaagacagaggtgcagggcgaggacggacaggtggtgctcatcaagcaggagaaagaccgagaagccaaattggcagagaatgcttgtaccctggctgacctgacagagggtcaggttggcaagctactcatccgcaagtctggaagggtgcaactcctcttgggcaaggtgactctggacgtgaccatgggaactgcctgctccttcctgcaggagctggtgtccgtgggccttggagacagtaggacaggggagatgacagtcctgggacacgtgaagcacaaacttgtatgttcccctgattttgaatccctcttggatcacaaacaccggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: