SLC39A14-solute carrier family 39 (zinc transporter), member 14 Gene View larger

SLC39A14-solute carrier family 39 (zinc transporter), member 14 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC39A14-solute carrier family 39 (zinc transporter), member 14 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC39A14-solute carrier family 39 (zinc transporter), member 14 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015770
Product type: DNA & cDNA
Ncbi symbol: SLC39A14
Origin species: Human
Product name: SLC39A14-solute carrier family 39 (zinc transporter), member 14 Gene
Size: 2ug
Accessions: BC015770
Gene id: 23516
Gene description: solute carrier family 39 (zinc transporter), member 14
Synonyms: HMNDYT2; LZT-Hs4; NET34; ZIP14; cig19; zinc transporter ZIP14; LIV-1 subfamily of ZIP zinc transporter 4; ZIP-14; Zrt-, Irt-like protein 14; solute carrier family 39 (metal ion transporter), member 14; solute carrier family 39 (zinc transporter), member 14; zrt- and Irt-like protein 14; solute carrier family 39 member 14
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagctgctgctgctgcacccggccttccagagctgcctcctgctgaccctgcttggcttatggagaaccacccctgaggctcacgcttcatccccgggtgcaccagctatcagcgctgcctccttcctgcaggatctaatacatcggtatggcgagggtgacagcctcactctgcagcagctgaaggccctgctcaaccacctggatgtgggagtgggccggggtaatgtcacccagcacgtgcaaggacacaggaacctctccacgtgctttagttctggagacctcttcactgcccacaatttcagcgagcagtcgcggattgggagcagcgagctccaggagttctgccccaccatcctccagcagctggattcccgggcctgcacctcggagaaccaggaaaacgaggagaatgagcagacggaggaggggcggccaagcgctgttgaagtgtggggatacggtctcctctgtgtgaccgtcatctccctctgctccctcctgggggccagcgtggtgcccttcatgaagaagaccttttacaagaggctgctgctctacttcatagctctggcgattggaaccctctactccaacgccctcttccagctcatcccggaggcatttggtttcaaccctctggaagattattatgtctccaagtctgcagtggtgtttgggggcttttatcttttctttttcacagagaagatcttgaagattcttcttaagcagaaaaatgagcatcatcatggacacagccattatgcctctgagtcgcttccctccaagaaggaccaggaggagggggtgatggagaagctgcagaacggggacctggaccacatgattcctcagcactgcagcagtgagctggacggcaaggcgcccatggtggacgagaaggtcattgtgggctcgctctctgtgcaggacctgcaggcttcccagagtgcttgctactggctgaaaggtgtccgctactctgatatcggcactctggcctggatgatcactctgagcgacggcctccataatttcatcgatggcctggccatcggtgcttccttcactgtgtcagttttccaaggcatcagcacctcggtggccatcctctgtgaggagttcccacatgagctaggagactttgtcatcctgctcaacgctgggatgagcatccaacaagctctcttcttcaacttcctttctgcctgctgctgctacctgggtctggcctttggcatcctggccggcagccacttctctgccaactggatttttgcgctagctggaggaatgttcttgtatatttctctggctgatatgatggagttttgctctgttgcccaggctggagtgcaatggtgccatctcagctcactgcaacctctgccgcttgggttgaagcgattatcctgtctaagcctcccgagtaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - multiple inositol polyphosphate histidine phosphatase, 1
- CAP-GLY domain containing linker protein family, member 4
- ATP-binding cassette, sub-family C (CFTR/MRP), member 11
- adenosine deaminase domain containing 1 (testis-specific)

Buy SLC39A14-solute carrier family 39 (zinc transporter), member 14 Gene now

Add to cart