Login to display prices
Login to display prices
CHST4-carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4 Gene View larger

CHST4-carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4 Gene

PTXBC035282

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CHST4-carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CHST4-carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4 Gene

Proteogenix catalog: PTXBC035282
Ncbi symbol: CHST4
Product name: CHST4-carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4 Gene
Size: 2ug
Accessions: BC035282
Gene id: 10164
Gene description: carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4
Synonyms: GST3; GlcNAc6ST2; HECGLCNAC6ST; LSST; carbohydrate sulfotransferase 4; GST-3; HEC-GlcNAc6ST; L-selectin ligand sulfotransferase; N-acetylglucosamine 6-O-sulfotransferase 2; carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4; galactose/N-acetylglucosamine/N-acetylgalactosamine 6-O-sulfotransferase 3; galactose/N-acetylglucosamine/N-acetylglucosamine 6-O-sulfotransferase 3; glcNAc6ST-2; gn6st-2; high endothelial cells N-acetylglucosamine 6-O-sulfotransferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccatcttggctctattcttccacatgtacagccacaacatcagctccctgtctatgaaggcacagcccgagcgcatgcacgtgctggttctgtcttcctggcgctctggctcttcttttgtggggcagctttttgggcagcacccagatgttttctacctgatggagcccgcctggcacgtgtggatgaccttcaagcagagcaccgcctggatgctgcacatggctgtgcgggatctgatacgggccgtcttcttgtgcgacatgagcgtctttgatgcctacatggaacctggtccccggagacagtccagcctctttcagtgggagaacagccgggccctgtgttctgcacctgcctgtgacatcatcccacaagatgaaatcatcccccgggctcactgcaggctcctgtgcagtcaacagccctttgaggtggtggagaaggcctgccgctcctacagccacgtggtgctcaaggaggtgcgcttcttcaacctgcagtccctctacccgctgctgaaagacccctccctcaacctgcatatcgtgcacctggtccgggacccccgggccgtgttccgttcccgagaacgcacaaagggagatctcatgattgacagtcgcattgtgatggggcagcatgagcaaaaactcaagaaggaggaccaaccctactatgtgatgcaggtcatctgccaaagccagctggagatctacaagaccatccagtccttgcccaaggccctgcaggaacgctacctgcttgtgcgctatgaggacctggctcgagcccctgtggcccagacttcccgaatgtatgaattcgtgggattggaattcttgccccatcttcagacctgggtgcataacatcacccgaggcaagggcatgggtgaccacgctttccacacaaatgccagggatgcccttaatgtctcccaggcttggcgctggtctttgccctatgaaaaggtttctcgacttcagaaagcctgtggcgatgccatgaatttgctgggctaccgccacgtcagatctgaacaagaacagagaaacctgttgctggatcttctgtctacctggactgtccctgagcaaatccactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: