CHST4-carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4 Gene View larger

CHST4-carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CHST4-carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CHST4-carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035282
Product type: DNA & cDNA
Ncbi symbol: CHST4
Origin species: Human
Product name: CHST4-carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4 Gene
Size: 2ug
Accessions: BC035282
Gene id: 10164
Gene description: carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4
Synonyms: GST3; GlcNAc6ST2; HECGLCNAC6ST; LSST; carbohydrate sulfotransferase 4; GST-3; HEC-GlcNAc6ST; L-selectin ligand sulfotransferase; N-acetylglucosamine 6-O-sulfotransferase 2; carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4; galactose/N-acetylglucosamine/N-acetylgalactosamine 6-O-sulfotransferase 3; galactose/N-acetylglucosamine/N-acetylglucosamine 6-O-sulfotransferase 3; glcNAc6ST-2; gn6st-2; high endothelial cells N-acetylglucosamine 6-O-sulfotransferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccatcttggctctattcttccacatgtacagccacaacatcagctccctgtctatgaaggcacagcccgagcgcatgcacgtgctggttctgtcttcctggcgctctggctcttcttttgtggggcagctttttgggcagcacccagatgttttctacctgatggagcccgcctggcacgtgtggatgaccttcaagcagagcaccgcctggatgctgcacatggctgtgcgggatctgatacgggccgtcttcttgtgcgacatgagcgtctttgatgcctacatggaacctggtccccggagacagtccagcctctttcagtgggagaacagccgggccctgtgttctgcacctgcctgtgacatcatcccacaagatgaaatcatcccccgggctcactgcaggctcctgtgcagtcaacagccctttgaggtggtggagaaggcctgccgctcctacagccacgtggtgctcaaggaggtgcgcttcttcaacctgcagtccctctacccgctgctgaaagacccctccctcaacctgcatatcgtgcacctggtccgggacccccgggccgtgttccgttcccgagaacgcacaaagggagatctcatgattgacagtcgcattgtgatggggcagcatgagcaaaaactcaagaaggaggaccaaccctactatgtgatgcaggtcatctgccaaagccagctggagatctacaagaccatccagtccttgcccaaggccctgcaggaacgctacctgcttgtgcgctatgaggacctggctcgagcccctgtggcccagacttcccgaatgtatgaattcgtgggattggaattcttgccccatcttcagacctgggtgcataacatcacccgaggcaagggcatgggtgaccacgctttccacacaaatgccagggatgcccttaatgtctcccaggcttggcgctggtctttgccctatgaaaaggtttctcgacttcagaaagcctgtggcgatgccatgaatttgctgggctaccgccacgtcagatctgaacaagaacagagaaacctgttgctggatcttctgtctacctggactgtccctgagcaaatccactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - brain and reproductive organ-expressed (TNFRSF1A modulator)
- polymerase (RNA) III (DNA directed) polypeptide D, 44kDa
- polymerase (RNA) III (DNA directed) polypeptide C (62kD)
- acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain

Buy CHST4-carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4 Gene now

Add to cart