Cart 21 Product Products 2 598,99 € (empty)
-
-
1 x COPS7B-COP...113,40 € -
1 x ANKS6-anky...121,50 € -
1 x APEX1-APEX...121,50 € -
1 x GDF3-growt...121,50 € -
-
-
1 x WDR31-WD...121,50 € -
1 x PIK3R5-pho...121,50 € -
1 x WDR21A-WD...121,50 € -
1 x OCEL1-occl...113,40 € -
1 x WNT7B-wing...121,50 € -
-
1 x ALG2-aspar...113,40 € -
1 x Histone H4...259,07 € -
-
1 x ARAP3-ArfG...113,40 € -
1 x TBC1D10C-T...121,50 € -
-
1 x POU2AF1-PO...113,40 € -
No products
To be determined Shipping
2 598,99 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 21 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 598,99 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 598,99 €
View larger 
SLC39A13-solute carrier family 39 (zinc transporter), member 13 Gene
PTXBC019016
New product
Data sheet of SLC39A13-solute carrier family 39 (zinc transporter), member 13 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC39A13-solute carrier family 39 (zinc transporter), member 13 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC019016 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC39A13 |
| Origin species: | Human |
| Product name: | SLC39A13-solute carrier family 39 (zinc transporter), member 13 Gene |
| Size: | 2ug |
| Accessions: | BC019016 |
| Gene id: | 91252 |
| Gene description: | solute carrier family 39 (zinc transporter), member 13 |
| Synonyms: | LZT-Hs9; zinc transporter ZIP13; LIV-1 subfamily of ZIP zinc transporter 9; solute carrier family 39 (metal ion transporter), member 13; solute carrier family 39 (zinc transporter), member 13; zrt- and Irt-like protein 13; solute carrier family 39 member 13 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctggatgtccctgccctggctgtggcatggcgggcccaaggctcctcttcctcactgcccttgccctggagctcttgggaagggctgggggttcccagccggccctccggagccgggggactgcgacggcctgtcgcctggacaacaaggaaagcgagtcctggggggctctgctgagcggagagcggctggacacctggatctgctccctcctgggttccctcatggtggggctcagtggggtcttcccgttgcttgtcattcccctagagatggggaccatgctgcgctcagaagctggggcctggcgcctgaagcagctgctcagcttcgccctggggggactcttgggcaatgtgtttctgcatctgctgcccgaagcctgggcctacacgtgcagcgccagccctggtggtgaggggcagagcctgcagcagcagcaacagctggggctgtgggtcattgctggcatcctgaccttcctggcgttggagaagatgttcctggacagcaaggaggaggggaccagccaggcccccaacaaagaccccactgctgctgccgccgcactcaatggaggccactgtctggcccagccggctgcagagcccggcctcggtgccgtggtccggagcatcaaagtcagcggctacctcaacctgctggccaacaccatcgataacttcacccacgggctggctgtggctgccagcttccttgtgagcaagaagatcgggctcctgacaaccatggccatcctcctgcatgagatcccccatgaggtgggcgactttgccatcctgctccgggccggctttgaccgatggagcgcagccaagctgcaactctcaacagcgctggggggcctactgggcgctggcttcgccatctgtacccagtcccccaagggagtagaggagacggcagcctgggtcctgcccttcacctctggcggctttctctacatcgccttggtgaacgtgctccctgacctcttggaagaagaggacccgtggcgctccctgcagcagctgcttctgctctgtgcgggcatcgtggtaatggtgctgttctcgctcttcgtggattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4 - brain and reproductive organ-expressed (TNFRSF1A modulator) - polymerase (RNA) III (DNA directed) polypeptide D, 44kDa - polymerase (RNA) III (DNA directed) polypeptide C (62kD) |