Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CMPK2-cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial Gene
PTXBC141802
New product
Data sheet of CMPK2-cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CMPK2-cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC141802 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CMPK2 |
| Origin species: | Human |
| Product name: | CMPK2-cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial Gene |
| Size: | 2ug |
| Accessions: | BC141802 |
| Gene id: | 129607 |
| Gene description: | cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial |
| Synonyms: | UMP-CMPK2; NDK; TMPK2; TYKi; UMP-CMP kinase 2, mitochondrial; UMP/CMP kinase; cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial; cytidylate kinase 2; mitochondrial UMP-CMP kinase; nucleoside-diphosphate kinase; thymidine monophosphate kinase 2; thymidylate kinase family LPS-inducible member; cytidine/uridine monophosphate kinase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccttcgcccgccggctcctgcgcgggccactgtcggggccgctgctcgggcggcgcggggtctgcgctggggccatggctccgccgcgccgcttcgtcctggagcttcccgactgcaccctggctcacttcgccctaggcgccgacgcccccggcgacgcagacgcccccgacccccgcctggcggcgctgctggggcccccggagcgcagctactcgctgtgcgtgcccgtgaccccggacgccggctgcggggcccgggtccgggcggcgcggctgcaccagcgcctgctgcaccagctgcgccgcggccccttccagcggtgccagctgctcaggctgctctgctactgcccgggcggccaggccggcggcgcacagcaaggcttcctgctgcgcgaccccctggatgaccctgacacccggcaagcgctgctcgagctgctgggcgcctgccaggaggcaccacgcccgcacttgggcgagttcgaggccgacccgcgcggccagctgtggcagcgcctctgggaggtgcaagacggcaggcggctgcaggtgggctgcgcacaggtcgtgcccgtcccggagcccccgctgcacccggtggtgccagacttgcccagttccgtggtcttcccggaccgggaagccgcccgggccgttttggaggagtgtacctcctttattcctgaagcccgggcagtgcttgacctggtcgaccagtgcccaaaacagatccagaaaggaaagttccaggttgttgccatcgaaggactggatgccacgggtaaaaccacggtgacccagtcagtggcagattcacttaaggctgtcctcttaaagtcaccaccctcttgcattggccagtggaggaagatctttgatgatgaaccaactatcattagaagagctttttactctttgggcaattatattgtggcctccgaaatagctaaagaatctgccaaatctcctgtgattgtagacaggtactggcacagcacggccacctatgccatagccactgaggtgagtgggggtctccagcacctgcccccagcccatcaccctgtgtaccagtggccagaggacctgctcaaacctgaccttatcctgctgctcactgtgagtcctgaggagaggttgcagaggctgcagggccggggcatggagaagaccagggaagaagcagaacttgaggccaacagtgtgtttcgtcaaaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - MMS19 nucleotide excision repair homolog (S. cerevisiae) - glutamate receptor, ionotropic, N-methyl D-aspartate 2B - phosphoinositide-3-kinase, catalytic, alpha polypeptide - v-rel reticuloendotheliosis viral oncogene homolog (avian) |