Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC10A2-solute carrier family 10 (sodium/bile acid cotransporter family), member 2 Gene
PTXBC130521
New product
Data sheet of SLC10A2-solute carrier family 10 (sodium/bile acid cotransporter family), member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC10A2-solute carrier family 10 (sodium/bile acid cotransporter family), member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC130521 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC10A2 |
| Origin species: | Human |
| Product name: | SLC10A2-solute carrier family 10 (sodium/bile acid cotransporter family), member 2 Gene |
| Size: | 2ug |
| Accessions: | BC130521 |
| Gene id: | 6555 |
| Gene description: | solute carrier family 10 (sodium/bile acid cotransporter family), member 2 |
| Synonyms: | ASBT; IBAT; ISBT; NTCP2; PBAM; ileal sodium/bile acid cotransporter; Na(+)-dependent ileal bile acid transporter; ileal apical sodium-dependent bile acid transporter; ileal sodium-dependent bile acid transporter; sodium/taurocholate cotransporting polypeptide, ileal; solute carrier family 10 (sodium/bile acid cotransporter family), member 2; solute carrier family 10 (sodium/bile acid cotransporter), member 2; solute carrier family 10 member 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaatgatccgaacagctgtgtggacaatgcaacagtttgctctggtgcatcctgtgtggtacctgagagcaatttcaataacatcctaagtgtggtcctaagtacggtgctgaccatcctgttggccttggtgatgttctccatgggatgcaacgtggaaatcaagaaatttctagggcacataaagcggccgtggggcatttgtgttggcttcctctgtcagtttggaatcatgcccctcacaggattcatcctgtcggtggcctttgacatcctcccgctccaggccgtagtggtgctcattataggatgctgccctggaggaactgcctccaatatcttggcctattgggtcgatggcgacatggacctgagcgtcagcatgaccacatgctccacactgcttgccctcggaatgatgccgctgtgcctccttatctataccaaaatgtgggtcgactctgggagcatcgtaattccctatgataacataggtacatctctggttgctctcgttgttcctgtttccattggaatgtttgttaatcacaaatggccccaaaaagcaaagatcatacttaaaattgggtccatcgcgggcgccatcctcattgtgctcatagctgtggttggaggaatattgtaccaaagcgcctggatcattgctcccaaactgtggattataggaacaatatttcctgtggcgggttactccctggggtttcttctggctagaattgctggtctaccctggtacaggtgccgaacggttgcttttgaaacggggatgcagaacacgcagctatgttccaccatcgttcagctctccttcactcctgaggagctcaatgtcgtattcaccttcccgctcatctacagcattttccagctcgcctttgccgcaatattcttaggattttatgtggcatacaagaaatgtcatggaaaaaacaaggcagaaattccagagagcaaagaaaatggaacggagccagagtcatcgttttataaggcaaatggaggatttcaacctgacgaaaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 28 (sodium-coupled nucleoside transporter), member 1 - solute carrier family 6 (neurotransmitter transporter, L-proline), member 7 - solute carrier family 10 (sodium/bile acid cotransporter family), member 6 - family with sequence similarity 19 (chemokine (C-C motif)-like), member A3 |