SERGEF-secretion regulating guanine nucleotide exchange factor Gene View larger

SERGEF-secretion regulating guanine nucleotide exchange factor Gene

PTXBC065375

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SERGEF-secretion regulating guanine nucleotide exchange factor Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SERGEF-secretion regulating guanine nucleotide exchange factor Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC065375
Product type: DNA & cDNA
Ncbi symbol: SERGEF
Origin species: Human
Product name: SERGEF-secretion regulating guanine nucleotide exchange factor Gene
Size: 2ug
Accessions: BC065375
Gene id: 26297
Gene description: secretion regulating guanine nucleotide exchange factor
Synonyms: DELGEF; Gnefr; secretion-regulating guanine nucleotide exchange factor; deafness locus associated putative guanine nucleotide exchange factor; guanine nucleotide exchange factor-related protein; secretion regulating guanine nucleotide exchange factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcgcgagcccagcgcctcggaggccgcccccgcggcggccgcgctcttcgcctggggtgcaaatagctatgggcaacttggcctcggccataaggaagatgtgctgttgccccagcaactgaatgacttctgtaaacccaggagtgtcaggaggatcacaggaggagggggccactctgcagttgtcacagatggaggagacctctttgtttgtggcctgaacaaagatgggcaactggggcttggtcacacagaggatatcccatattttaccccctgcaaatccctctttggctgtcccatccaacaggtggcctgtggctgggattttacgattatgctcacagaaaatggtcaagttctatcatgtggatccaactcctttggccagttaggagttcctcatggacctcgaagatgtgtggttccccaggccattgagctccataaagagaaggttgtttgtattgctgctggactgaggcatgcagtagctgctacagcgagtggcatcgtgttccagtgggggactggtttggcatcatgtggacgacggttgtgccctgggcagactcttccattgtttttcacagcaaaggaaccaagcagagtgacaggtctagagaattctaaagcaatgtgtgttcttgctggctcagaccactcagcttcattaacagatgcaggagaggtgtatgtttggggaagcaacaagcatgggcaactggctaatgaggctgctttccttcctgtgccccagaaaatagaagcacattgtttccagaatgaaaaggtcactgccatctggagtggatggacacacctggttgctcagacagaaactggcaagatgtttacctggggccgagcagactatggtcagctagggaggaagttggagacttatgaaggctggaaactagaaaagcaagattcatttctcccctgttcaagaccaccgaacagcatgccttcgtctccgcattgcttaactggagcaactgaggtctcttgtggctcagagcataatttggcaataattggtggagtgtgttactcttggggctggaatgagcatggcatgtgcggagatggcactgaagccaacgtctgggccccaaagccggtgcaggctctgctgtcatcgtcaggactccttgtgggctgtggggctggccactccttggccctctgccagctgccagctcaccctgcattggtccaggaccccaaggtcacctacctttccccagatgccatcgaggacactgaatctcagaaagccatggacaaagagagaaactggaaggaaagacaatcagaaacttcaacccaaagccaatctgactggtccagaaatgggggactgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)
- cytochrome P450, family 26, subfamily B, polypeptide 1
- cytochrome P450, family 2, subfamily C, polypeptide 18
- G protein-coupled receptor, family C, group 5, member D

Buy SERGEF-secretion regulating guanine nucleotide exchange factor Gene now

Add to cart