Login to display prices
Login to display prices
SERGEF-secretion regulating guanine nucleotide exchange factor Gene View larger

SERGEF-secretion regulating guanine nucleotide exchange factor Gene

PTXBC065375

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SERGEF-secretion regulating guanine nucleotide exchange factor Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SERGEF-secretion regulating guanine nucleotide exchange factor Gene

Proteogenix catalog: PTXBC065375
Ncbi symbol: SERGEF
Product name: SERGEF-secretion regulating guanine nucleotide exchange factor Gene
Size: 2ug
Accessions: BC065375
Gene id: 26297
Gene description: secretion regulating guanine nucleotide exchange factor
Synonyms: DELGEF; Gnefr; secretion-regulating guanine nucleotide exchange factor; deafness locus associated putative guanine nucleotide exchange factor; guanine nucleotide exchange factor-related protein; secretion regulating guanine nucleotide exchange factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcgcgagcccagcgcctcggaggccgcccccgcggcggccgcgctcttcgcctggggtgcaaatagctatgggcaacttggcctcggccataaggaagatgtgctgttgccccagcaactgaatgacttctgtaaacccaggagtgtcaggaggatcacaggaggagggggccactctgcagttgtcacagatggaggagacctctttgtttgtggcctgaacaaagatgggcaactggggcttggtcacacagaggatatcccatattttaccccctgcaaatccctctttggctgtcccatccaacaggtggcctgtggctgggattttacgattatgctcacagaaaatggtcaagttctatcatgtggatccaactcctttggccagttaggagttcctcatggacctcgaagatgtgtggttccccaggccattgagctccataaagagaaggttgtttgtattgctgctggactgaggcatgcagtagctgctacagcgagtggcatcgtgttccagtgggggactggtttggcatcatgtggacgacggttgtgccctgggcagactcttccattgtttttcacagcaaaggaaccaagcagagtgacaggtctagagaattctaaagcaatgtgtgttcttgctggctcagaccactcagcttcattaacagatgcaggagaggtgtatgtttggggaagcaacaagcatgggcaactggctaatgaggctgctttccttcctgtgccccagaaaatagaagcacattgtttccagaatgaaaaggtcactgccatctggagtggatggacacacctggttgctcagacagaaactggcaagatgtttacctggggccgagcagactatggtcagctagggaggaagttggagacttatgaaggctggaaactagaaaagcaagattcatttctcccctgttcaagaccaccgaacagcatgccttcgtctccgcattgcttaactggagcaactgaggtctcttgtggctcagagcataatttggcaataattggtggagtgtgttactcttggggctggaatgagcatggcatgtgcggagatggcactgaagccaacgtctgggccccaaagccggtgcaggctctgctgtcatcgtcaggactccttgtgggctgtggggctggccactccttggccctctgccagctgccagctcaccctgcattggtccaggaccccaaggtcacctacctttccccagatgccatcgaggacactgaatctcagaaagccatggacaaagagagaaactggaaggaaagacaatcagaaacttcaacccaaagccaatctgactggtccagaaatgggggactgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: