DCLRE1C-DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae) Gene View larger

DCLRE1C-DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae) Gene

PTXBC009185

New product

Data sheet of DCLRE1C-DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DCLRE1C-DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae) Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC009185
Product type: DNA & cDNA
Ncbi symbol: DCLRE1C
Origin species: Human
Product name: DCLRE1C-DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae) Gene
Size: 2ug
Accessions: BC009185
Gene id: 64421
Gene description: DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)
Synonyms: A-SCID; DCLREC1C; RS-SCID; SCIDA; SNM1C; protein artemis; DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae); SNM1 homolog C; SNM1-like protein; severe combined immunodeficiency, type a (Athabascan); DNA cross-link repair 1C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagcatcaggagaggtttttatttcagggcaataatggaactgtcctgtacacaggagacttcagattggcgcaaggagaagctgctagaatggagcttctgcactccgggggcagagtcaaagacatccaaagtgtatatttggatactacgttctgtgatccaagattttaccaaattccaagtcgggaggagtgtttaagtggagtcttagagctggtccgaagctggatcactcggagcccgtaccatgttgtgtggctgaactgcaaagcggcttatggctatgaatatctgttcaccaaccttagtgaagaattaggagtccaggttcatgtgaataagctagacatgtttaggaacatgcctgagatccttcatcatctcacaacagaccgcaacactcagatccatgcatgccggcatcccaaggcagaggaatattttcagtggagcaaattaccctgtggaattacttccagaaatagaattccactccacataatcagcattaagccatccaccatgtggtttggagaaaggagcagaaaaacaaatgtaattgtgaggactggagagagttcatacagagcttgtttttcttttcactcctcctacagtgagattaaagatttcttgagctacctctgtcctgtgaacgcatatccaaatgtcattccagttggcacaactatggataaagttgtcgaaatcttaaagcctttatgccggtcttcccaaagtacggagccaaagtataaaccactgggaaaactgaagagagctagaacagttcaccgagactcagaggaggaagatgactatctctttgatgatcctctgccaatacctttaaggcacaaagttccatacccggaaacttttcaccctgaggtattttcaatgactgcagtatcagaaaagcagcctgaaaaactgagacaaaccccaggatgctgcagagcagagtgtatgcagagctctcgtttcacaaactttgtagattgtgaagaatccaacagtgaaagtgaagaagaagtaggaatcccagcttcactgcaaggagatctgggctctgtacttcacctgcaaaaggctgatggggatgtaccccagtgggaagtattctttaaaagaaatgatgaaatcacagatgagagtttggaaaacttcccttcctccacagtggcagggggatctcagtcaccaaagcttttcagtgactctgatggagaatcaactcacatctcctcccagaattcttcccagtcaacacacataacagaacaaggaagtcaaggctgggacagccaatctgatactgttttgttatcttcccaagagagaaacagtggggatattacttccttggacaaagctgactacagaccaacaatcaaagagaatattcctgcctctctcatggaacaaaatgtaatttgcccaaaggatacttactctgatttgaaaagcagagataaagatgtgacaatagttcctagtactggagaaccaactactctaagcagtgagacacatatacccgaggaaaaaagtttgctaaatcttagcacaaatgcagattcccagagctcttctgattttgaagttccctcaactccagaagctgagttacctaaacgagagcatttacaatatttatatgagaagctggcaactggtgagagtatagcagtcaaaaaaagaaaatgctcactcttagatacctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cytochrome P450, family 26, subfamily B, polypeptide 1
- cytochrome P450, family 2, subfamily C, polypeptide 18
- G protein-coupled receptor, family C, group 5, member D
- cytochrome P450, family 4, subfamily F, polypeptide 22

Buy DCLRE1C-DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae) Gene now

Add to cart