Login to display prices
Login to display prices
TRAPPC3-trafficking protein particle complex 3 Gene View larger

TRAPPC3-trafficking protein particle complex 3 Gene

PTXBC007662

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TRAPPC3-trafficking protein particle complex 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TRAPPC3-trafficking protein particle complex 3 Gene

Proteogenix catalog: PTXBC007662
Ncbi symbol: TRAPPC3
Product name: TRAPPC3-trafficking protein particle complex 3 Gene
Size: 2ug
Accessions: BC007662
Gene id: 27095
Gene description: trafficking protein particle complex 3
Synonyms: BET3; trafficking protein particle complex subunit 3; trafficking protein particle complex 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgaggcaggcgaaccgtggcaccgagagcaagaaaatgagctctgagctcttcaccctgacctatggtgccctggtcacccagctatgtaaggactatgaaaatgatgaagatgtgaataaacagctggacaaaatgggctttaacattggagtccggctgattgaagatttcttggctcggtcaaatgttgggaggtgccatgactttcgggaaactgcggatgtcattgccaaggtggcgttcaagatgtacttgggcatcactccaagcattactaattggagcccagctggtgatgaattctccctcattttggaaaataaccccttggtggactttgtggaacttcctgataaccactcatcccttatttattccaatctcttgtgtggggtgttgcggggagctttggagatggtccagatggctgtggaggccaagtttgtccaggacaccctgaaaggagacggtgtgacagaaatccggatgagattcatcaggcggattgaggacaatcttccagctggagaggaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice