TRAPPC3-trafficking protein particle complex 3 Gene View larger

TRAPPC3-trafficking protein particle complex 3 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TRAPPC3-trafficking protein particle complex 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TRAPPC3-trafficking protein particle complex 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007662
Product type: DNA & cDNA
Ncbi symbol: TRAPPC3
Origin species: Human
Product name: TRAPPC3-trafficking protein particle complex 3 Gene
Size: 2ug
Accessions: BC007662
Gene id: 27095
Gene description: trafficking protein particle complex 3
Synonyms: BET3; trafficking protein particle complex subunit 3; trafficking protein particle complex 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgaggcaggcgaaccgtggcaccgagagcaagaaaatgagctctgagctcttcaccctgacctatggtgccctggtcacccagctatgtaaggactatgaaaatgatgaagatgtgaataaacagctggacaaaatgggctttaacattggagtccggctgattgaagatttcttggctcggtcaaatgttgggaggtgccatgactttcgggaaactgcggatgtcattgccaaggtggcgttcaagatgtacttgggcatcactccaagcattactaattggagcccagctggtgatgaattctccctcattttggaaaataaccccttggtggactttgtggaacttcctgataaccactcatcccttatttattccaatctcttgtgtggggtgttgcggggagctttggagatggtccagatggctgtggaggccaagtttgtccaggacaccctgaaaggagacggtgtgacagaaatccggatgagattcatcaggcggattgaggacaatcttccagctggagaggaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - guanylate cyclase activator 1A (retina)
- immunoglobulin lambda-like polypeptide 1
- lysosomal protein transmembrane 4 beta
- zinc finger, CCHC domain containing 17

Buy TRAPPC3-trafficking protein particle complex 3 Gene now

Add to cart