Login to display prices
Login to display prices
LAPTM4B-lysosomal protein transmembrane 4 beta Gene View larger

LAPTM4B-lysosomal protein transmembrane 4 beta Gene

PTXBC014129

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LAPTM4B-lysosomal protein transmembrane 4 beta Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LAPTM4B-lysosomal protein transmembrane 4 beta Gene

Proteogenix catalog: PTXBC014129
Ncbi symbol: LAPTM4B
Product name: LAPTM4B-lysosomal protein transmembrane 4 beta Gene
Size: 2ug
Accessions: BC014129
Gene id: 55353
Gene description: lysosomal protein transmembrane 4 beta
Synonyms: LAPTM4beta; LC27; lysosomal-associated transmembrane protein 4B; lysosomal associated protein transmembrane 4 beta; lysosome-associated transmembrane protein 4-beta; lysosomal protein transmembrane 4 beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagatggtcgcgccctggacgcggttctactccaacagctgctgcttgtgctgccatgtccgcaccggcaccatcctgctcggcgtctggtatctgatcatcaatgctgtggtactgttgattttattgagtgccctggctgatccggatcagtataacttttcaagttctgaactgggaggtgactttgagttcatggatgatgccaacatgtgcattgccattgcgatttctcttctcatgatcctgatatgtgctatggctacttacggagcgtacaagcaacgcgcagcctggatcatcccattcttctgttaccagatctttgactttgccctgaacatgttggttgcaatcactgtgcttatttatccaaactccattcaggaatacatacggcaactgcctcctaattttccctacagagatgatgtcatgtcagtgaatcctacctgtttggtccttattattcttctgtttattagcattatcttgacttttaagggttacttgattagctgtgtttggaactgctaccgatacatcaatggtaggaactcctctgatgtcctggtttatgttaccagcaatgacactacggtgctgctacccccgtatgatgatgccactgtgaatggtgctgccaaggagccaccgccaccttacgtgtctgcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: