Login to display prices
Login to display prices
FYCO1-FYVE and coiled-coil domain containing 1 Gene View larger

FYCO1-FYVE and coiled-coil domain containing 1 Gene

PTXBC007218

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FYCO1-FYVE and coiled-coil domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FYCO1-FYVE and coiled-coil domain containing 1 Gene

Proteogenix catalog: PTXBC007218
Ncbi symbol: FYCO1
Product name: FYCO1-FYVE and coiled-coil domain containing 1 Gene
Size: 2ug
Accessions: BC007218
Gene id: 79443
Gene description: FYVE and coiled-coil domain containing 1
Synonyms: CATC2; CTRCT18; RUFY3; ZFYVE7; FYVE and coiled-coil domain-containing protein 1; RUN and FYVE domain containing 3; zinc finger FYVE domain-containing protein 7; FYVE and coiled-coil domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacaccaaagtgaccagtgactggtactatgcaagaagcccctttctgcagccaaagctgagctcggacattgtgggccaactctatgagctgactgaggttcagtttgacctggcgtcgaggggctttgacttggatgctgcctggccaacatttgccaggaggacgctgaccactggctcttctgcttacctgtggaaaccccctagccgcagctccagcatgagcagcttggtgagcagctacctgcagactcaagagatggtgtccaactttgacctgaacagccccctaaacaacgaggcattggagggctttgatgagatgcgactagagctggaccagttggaggtgcgggagaagcagctacaggagcgcatgcagcagctggacagagagaaccaggagctgagggcagctgtcagccagcaaggggagcaactgcagacagagagggagagggggcgcactgcagcggaggacaacgttcgcctcacttgcttggtagctgagctccagaagcagtgggaggtcacccaggccacccagaacactgtgaaggagctgcagacatgcctgcaggccctggagctaggagcagcagagaaggaggaggactaccacacagccctgcggcggctggagtccatgctgcagcccttggcacaggagcttgaggccacacgggactcactggacaagaaaaaccagcatttagccagcttcccaggctggctagccatggccctgcatgttggagactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: