Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FYCO1-FYVE and coiled-coil domain containing 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FYCO1-FYVE and coiled-coil domain containing 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007218 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FYCO1 |
| Origin species: | Human |
| Product name: | FYCO1-FYVE and coiled-coil domain containing 1 Gene |
| Size: | 2ug |
| Accessions: | BC007218 |
| Gene id: | 79443 |
| Gene description: | FYVE and coiled-coil domain containing 1 |
| Synonyms: | CATC2; CTRCT18; RUFY3; ZFYVE7; FYVE and coiled-coil domain-containing protein 1; RUN and FYVE domain containing 3; zinc finger FYVE domain-containing protein 7; FYVE and coiled-coil domain containing 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaacaccaaagtgaccagtgactggtactatgcaagaagcccctttctgcagccaaagctgagctcggacattgtgggccaactctatgagctgactgaggttcagtttgacctggcgtcgaggggctttgacttggatgctgcctggccaacatttgccaggaggacgctgaccactggctcttctgcttacctgtggaaaccccctagccgcagctccagcatgagcagcttggtgagcagctacctgcagactcaagagatggtgtccaactttgacctgaacagccccctaaacaacgaggcattggagggctttgatgagatgcgactagagctggaccagttggaggtgcgggagaagcagctacaggagcgcatgcagcagctggacagagagaaccaggagctgagggcagctgtcagccagcaaggggagcaactgcagacagagagggagagggggcgcactgcagcggaggacaacgttcgcctcacttgcttggtagctgagctccagaagcagtgggaggtcacccaggccacccagaacactgtgaaggagctgcagacatgcctgcaggccctggagctaggagcagcagagaaggaggaggactaccacacagccctgcggcggctggagtccatgctgcagcccttggcacaggagcttgaggccacacgggactcactggacaagaaaaaccagcatttagccagcttcccaggctggctagccatggccctgcatgttggagactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - OTU domain, ubiquitin aldehyde binding 1 - OTU domain, ubiquitin aldehyde binding 1 - procollagen C-endopeptidase enhancer 2 - chromosome 14 open reading frame 104 |