PCOLCE2-procollagen C-endopeptidase enhancer 2 Gene View larger

PCOLCE2-procollagen C-endopeptidase enhancer 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PCOLCE2-procollagen C-endopeptidase enhancer 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PCOLCE2-procollagen C-endopeptidase enhancer 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006265
Product type: DNA & cDNA
Ncbi symbol: PCOLCE2
Origin species: Human
Product name: PCOLCE2-procollagen C-endopeptidase enhancer 2 Gene
Size: 2ug
Accessions: BC006265
Gene id: 26577
Gene description: procollagen C-endopeptidase enhancer 2
Synonyms: PCPE2; procollagen C-endopeptidase enhancer 2; procollagen C-proteinase enhancer 2; procollagen COOH-terminal proteinase enhancer 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggggcgcgaacgcctgggcgccactctgcctgctgctggctgccgccacccagctctcgcggcagcagtccccagagagacctgttttcacatgtggtggcattcttactggagagtctggatttattggcagtgaaggttttcctggagtgtaccctccaaatagcaaatgtacttggaaaatcacagttcccgaaggaaaagtagtcgttctcaatttccgattcatagacctcgagagtgacaacctgtgccgctatgactttgtggatgtgtacaatggccatgccaatggccagcgcattggccgcttctgtggcactttccggcctggagcccttgtgtccagtggcaacaagatgatggtgcagatgatttctgatgccaacacagctggcaatggcttcatggccatgttctccgctgctgaaccaaacgaaagaggggatcagtattgtggaggactccttgacagaccttccggctcttttaaaacccccaactggccagaccgggattaccctgcaggagtcacttgtgtgtggcacattgtagccccaaagaatcagcttatagaattaaagtttgagaagtttgatgtggagcgagataactactgccgatatgattatgtggctgtgtttaatggcggggaagtcaacgatgctagaagaattggaaagtattgtggtgatagtccacctgcgccaattgtgtctgagagaaatgaacttcttattcagtttttatcagacttaagtttaactgcagatgggtttattggtcactacatattcaggccaaaaaaactgcctacaactacataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 14 open reading frame 104
- chromosome 14 open reading frame 172
- armadillo repeat containing, X-linked 6
- protein phosphatase 6, catalytic subunit

Buy PCOLCE2-procollagen C-endopeptidase enhancer 2 Gene now

Add to cart